ID: 1025012183

View in Genome Browser
Species Human (GRCh38)
Location 7:55406380-55406402
Sequence CAGAAGATGGGGGAGCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 368}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025012175_1025012183 20 Left 1025012175 7:55406337-55406359 CCTTCTCAGGAACAAGTGCTGGC 0: 1
1: 0
2: 0
3: 9
4: 168
Right 1025012183 7:55406380-55406402 CAGAAGATGGGGGAGCAGTCAGG 0: 1
1: 0
2: 1
3: 26
4: 368
1025012172_1025012183 28 Left 1025012172 7:55406329-55406351 CCCTGGTGCCTTCTCAGGAACAA 0: 1
1: 0
2: 0
3: 23
4: 195
Right 1025012183 7:55406380-55406402 CAGAAGATGGGGGAGCAGTCAGG 0: 1
1: 0
2: 1
3: 26
4: 368
1025012173_1025012183 27 Left 1025012173 7:55406330-55406352 CCTGGTGCCTTCTCAGGAACAAG 0: 1
1: 0
2: 1
3: 12
4: 184
Right 1025012183 7:55406380-55406402 CAGAAGATGGGGGAGCAGTCAGG 0: 1
1: 0
2: 1
3: 26
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025012183 Original CRISPR CAGAAGATGGGGGAGCAGTC AGG Intronic
900837985 1:5020941-5020963 GAGAAGATGGGGGCTCAGTCAGG - Intergenic
901446967 1:9314444-9314466 CAGAAGGTGGGTTGGCAGTCGGG - Intronic
902551347 1:17221503-17221525 AGGGAGATGGGGGATCAGTCGGG + Intronic
902634029 1:17723499-17723521 CAGAAGATGTGGAAGAAATCAGG - Intergenic
902832920 1:19029295-19029317 CCGGAGATGGGGCAGCAGGCGGG + Intergenic
904253202 1:29238690-29238712 CAGGACATGGGGGAGAAGTTGGG - Intronic
905022703 1:34828704-34828726 CAGAGGATGGGGCAGCAGAAGGG - Intronic
905850655 1:41272158-41272180 CAGAAGCAGGGGAAGCAGCCAGG - Intergenic
905895616 1:41544173-41544195 CAGAAAATGGCTGAGCAGTGTGG - Intronic
906302831 1:44696061-44696083 CAGAAGTTGAGGGAGCAGGGTGG + Intronic
906349555 1:45046264-45046286 CAGAAGAAGAGGGAGAAGTCAGG + Intronic
906516394 1:46441252-46441274 CAGAAGCTGGGGCAGGACTCAGG - Intergenic
907861565 1:58358596-58358618 CAGAAGGTGGGGATGCAGCCTGG + Intronic
911055147 1:93702387-93702409 GATAAGTTGGGGGAACAGTCAGG - Intronic
911271587 1:95808175-95808197 CAGAAGATAGGGAGGCAGTGCGG - Intergenic
912204596 1:107495872-107495894 GAGAGGCTGGGGGAGCAGGCTGG - Intergenic
912474643 1:109927860-109927882 TAGAAGATGGGGCAGCAGGCTGG + Intronic
913179919 1:116311453-116311475 CAGAAGAGGGAAGAGCAGACTGG - Intergenic
915022994 1:152798495-152798517 CAGAGGATGGGGAAGGGGTCAGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917124735 1:171677084-171677106 CAGAGGAGAGGGGAACAGTCAGG + Intergenic
918112532 1:181469726-181469748 AAGAAGATGAAGGAGCAGTTAGG + Intronic
919658613 1:200221687-200221709 CGGAAGCTGGGGGAGAAGGCAGG - Intergenic
919690476 1:200524280-200524302 CAGAATATCAGGGAGCAGTTAGG - Intergenic
922549243 1:226482026-226482048 CAGGAGATGGGGGAGAAGCCTGG - Intergenic
923961714 1:239092215-239092237 CAAAAGTTGGGGGAGCAGATGGG + Intergenic
924362843 1:243259188-243259210 CAGGAGATGGGAGACCAGCCTGG + Intronic
924546005 1:245028662-245028684 CAGAATATGAAGGAGCAATCAGG + Intronic
924612912 1:245588714-245588736 CAGAGGATGGGGAACCAGTTGGG - Intronic
1063128311 10:3154835-3154857 CAGCCGCTGGGGGAGCAGCCGGG - Intronic
1063629862 10:7723288-7723310 GAGGAGGTGGGGGAGCAGGCAGG + Intronic
1064106293 10:12503480-12503502 CAGAAGAAGGGAGAGCAGAGAGG + Intronic
1064662958 10:17624493-17624515 CAGCAGCTTGGGGAGCAGTTGGG - Intergenic
1065864170 10:29899171-29899193 CAGAAGTTGGGGGAGATTTCTGG + Intergenic
1066056545 10:31686362-31686384 CACAAAATGGCTGAGCAGTCTGG + Intergenic
1066975968 10:42367908-42367930 CAGAGTACGGGGGAGCAGTTGGG + Intergenic
1067149072 10:43714807-43714829 CAGAAGATGGAAGAGCACTTTGG - Intergenic
1067557034 10:47279649-47279671 CTCAAGATGGGGGAACAGCCTGG + Intergenic
1068733367 10:60384994-60385016 CAGCAGCAGGGAGAGCAGTCAGG - Intronic
1069152170 10:64976636-64976658 CAGAAGATGGGAGGGGTGTCTGG + Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070704600 10:78628640-78628662 CAGAAGTATGAGGAGCAGTCTGG - Intergenic
1070948600 10:80413139-80413161 CAGTAGATGGGGGGGCAGGGAGG - Intronic
1071486852 10:86107879-86107901 CAGCAGATGGGGGAGCAAGAAGG - Intronic
1072035670 10:91561012-91561034 CATGAGATGTGGGAGCGGTCAGG - Intergenic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072766302 10:98097567-98097589 CAGGGGATGGGGAAGCAGGCTGG - Intergenic
1073097151 10:100986888-100986910 CAGAAGCTGGCCGACCAGTCGGG - Exonic
1073469446 10:103713802-103713824 CAGCAGGTGGGGGAGGAGCCAGG + Intronic
1073475387 10:103749189-103749211 CAGGAGCTCGGGGAGCAGCCTGG + Intronic
1073562943 10:104512332-104512354 CAGTACATGGGTGAACAGTCAGG - Intergenic
1073831195 10:107385255-107385277 CAGAAGATGGAGGATCAGAGAGG - Intergenic
1073877402 10:107940859-107940881 CAGAAGAAGGGAGAACAGTGTGG + Intergenic
1075558798 10:123453107-123453129 TAGAAGATGGGGGAGGAGAAAGG - Intergenic
1076538749 10:131200043-131200065 CAGAGGAGGGGAGAGCTGTCGGG - Intronic
1076733009 10:132447503-132447525 CTGAAGGTGGGGGCGCAGTGGGG + Intronic
1076790335 10:132773832-132773854 CAGAAGATGGGGCTGCAGTGAGG - Intronic
1077050393 11:563751-563773 CAGGAGCTGGGGGTGCAGTGGGG + Exonic
1077471130 11:2761127-2761149 CAGCAGATGGGGGAGCAAGAAGG + Intronic
1077484843 11:2833929-2833951 GAGGAGGTGGGGGAGCAGGCTGG - Intronic
1077508369 11:2942662-2942684 CAGGAGTTTGGGGAGCAGCCCGG - Intergenic
1079413465 11:20210926-20210948 CAGAAGATGGCAGAGCAGTTAGG + Intergenic
1080638183 11:34141671-34141693 CAGAAGATGAAGGAGCAGCAGGG - Intronic
1081524246 11:43913940-43913962 CAGAAGAGGGGGCAGCACTGGGG + Intronic
1082207235 11:49452408-49452430 CAGAAGAAAAGGAAGCAGTCTGG - Intergenic
1082819578 11:57535736-57535758 TAGAAGTGGGGAGAGCAGTCAGG - Intergenic
1083615629 11:64024726-64024748 GAGAAGATGAGGGAGGAGTTGGG + Intronic
1083653630 11:64218828-64218850 TGGAACATGGGGAAGCAGTCAGG - Intronic
1083778472 11:64906194-64906216 CTGAGGGTGGGGGCGCAGTCAGG + Intronic
1084143573 11:67250639-67250661 CAGAGGAGGGGGGTGCAGCCAGG + Exonic
1084454606 11:69261219-69261241 CAGGAGATGGGGCAGGAGACTGG - Intergenic
1086648041 11:89249325-89249347 CAGAAGAAAAGGAAGCAGTCTGG + Intronic
1086666188 11:89486210-89486232 CAGAAGATGAGACAGAAGTCAGG + Intronic
1087286011 11:96265829-96265851 CAGCAGATGGGGGAGCCATAAGG - Intronic
1087972633 11:104503708-104503730 CAGATGATGGGGGAGACCTCAGG + Intergenic
1089379616 11:118018365-118018387 CTGGAGAAGGGGGACCAGTCAGG + Intergenic
1090075367 11:123577395-123577417 CGGAGGATGGGCGAGCAGGCCGG - Exonic
1091036472 11:132238270-132238292 CATAAGATGGGGGAGGATTGTGG + Intronic
1091953519 12:4615709-4615731 CAGAAGAGGGGAAAGCAGTGGGG + Exonic
1091997101 12:5002250-5002272 CAGGAGATGGAGGAACAGTGTGG + Intergenic
1093420673 12:18970817-18970839 CTGAAGATGGCACAGCAGTCAGG + Intergenic
1094334386 12:29332029-29332051 CACAACATGGGGGAGGAGTAGGG - Intronic
1095422154 12:42035894-42035916 CAGAAGATGGTGGAACCGTGTGG - Intergenic
1096675475 12:53223467-53223489 CAGGAGAGGGGGGTGCAGCCTGG + Intronic
1096811291 12:54172043-54172065 CAGAAGCAGGGAGACCAGTCAGG - Intronic
1096970838 12:55665038-55665060 GAGAAGATGGGGAAGCACTGTGG - Intergenic
1098360604 12:69650848-69650870 AAGAAGATGTGGGAGGAGTTGGG + Intronic
1098465030 12:70776788-70776810 CAAAAGAAGGGGGAGAAGTCAGG - Intronic
1099624571 12:85053580-85053602 CAGAAAATGGAGGAAGAGTCAGG - Intronic
1100529846 12:95453087-95453109 CAGAGGATGGGGAACCAATCGGG - Intergenic
1100539048 12:95540776-95540798 CAGATGATGGGAGACCAGTTTGG - Intronic
1100616072 12:96232615-96232637 CAGGAGATGGGGGAGGGGGCGGG + Intronic
1101933978 12:109040888-109040910 CAGAACATGGGGGATCATTGGGG + Intronic
1102569816 12:113820634-113820656 GAGGAGATGAGGGTGCAGTCTGG + Intronic
1102736438 12:115164953-115164975 GAGATGATGGGGAAGCAGCCTGG + Intergenic
1103674293 12:122643546-122643568 CAGCAGATGGGGGATGAGCCTGG + Intergenic
1103781338 12:123400708-123400730 GAGAAGATGGGTAAGGAGTCTGG - Intronic
1103804608 12:123562702-123562724 CAAAAGGAGGGGGAGCAGGCCGG + Intergenic
1104640421 12:130463490-130463512 CAGGAGCTGGGGGAGCTGTGGGG - Intronic
1104973886 12:132543456-132543478 CAGAAGCTGGGGGAGGTGTTGGG + Intronic
1105991726 13:25628675-25628697 CAGAAGCTGGAGGAGAAGCCTGG - Intronic
1106079491 13:26488344-26488366 CAGAGGATGGGGGAGAAGTCAGG + Intergenic
1106331698 13:28745363-28745385 CAGGAGTTGGGAGACCAGTCTGG - Intergenic
1106333402 13:28761390-28761412 CAGAAGTTGGGGCACCAGCCAGG + Intergenic
1106720656 13:32431596-32431618 CAGAAGATCTGGGAGAAGTAGGG + Intergenic
1107731695 13:43355652-43355674 GAGAACATGGGTGAGCATTCTGG + Intronic
1109220137 13:59633341-59633363 CGGAAGCAGGGGGACCAGTCAGG - Intergenic
1111060735 13:83015721-83015743 CAGAAGTTGAGGCTGCAGTCAGG + Intergenic
1114207960 14:20590822-20590844 CCAAGGATGGGGGAGCAGCCAGG - Exonic
1114635690 14:24185549-24185571 CAGCAGTGGGGGCAGCAGTCTGG + Exonic
1115142834 14:30193546-30193568 GAGAAGATGGTGGAGTATTCAGG + Intergenic
1116306309 14:43262043-43262065 AAGAAGAAGAGGGAGAAGTCGGG + Intergenic
1117627404 14:57653935-57653957 CAGAAGCTAGGGGAGCAGCATGG - Intronic
1117878387 14:60280688-60280710 CAGAAGATGGGGGCACATTAAGG - Intronic
1118092376 14:62497023-62497045 CACATGTTGGGGGAGTAGTCTGG - Intergenic
1118444161 14:65836903-65836925 CAGAAGATTGGAGAGCTCTCAGG + Intergenic
1118744358 14:68763138-68763160 AAGGAGAAGGGGGAGGAGTCTGG - Intergenic
1118876884 14:69793541-69793563 CAGAAGCTGAGGGAGCTGTGAGG + Intronic
1118896523 14:69949938-69949960 CAGAAGAGGGGTGAGCTGACGGG - Intronic
1119825990 14:77657346-77657368 CAGGAGAGGAGGGAGCAGTGGGG + Intergenic
1119955002 14:78788437-78788459 CAGAAGACAAGGGAGCTGTCAGG - Intronic
1120107875 14:80516810-80516832 CAGAAGTTGGGGGAGGAGTGGGG + Intronic
1121316929 14:92967483-92967505 CAGAAGCTTGGGAAACAGTCTGG + Intronic
1121948868 14:98151436-98151458 CAGCAGATGTGTGAGCAATCTGG + Intergenic
1122097438 14:99381922-99381944 CTGGAGCTGGGGGAGCAGGCAGG - Intergenic
1122112468 14:99511933-99511955 CCGCAGATGGGGGCTCAGTCGGG - Exonic
1122207549 14:100155553-100155575 CTGAAGATCTGGGAGCAGCCAGG + Intronic
1122397170 14:101441826-101441848 GAGACGATGGGGCAGCAGACAGG - Intergenic
1123131992 14:105994555-105994577 CAGTAGATGGAGGGGCACTCAGG + Intergenic
1123582228 15:21725685-21725707 CAGTAGATGGAGGGGCACTCAGG + Intergenic
1123618878 15:22168281-22168303 CAGTAGATGGAGGGGCACTCAGG + Intergenic
1123737282 15:23197686-23197708 CAGAAGCTGGGAGACCAGTTAGG + Intergenic
1124279454 15:28350543-28350565 GAGAAGATGGGGGAGCAGGAGGG - Intergenic
1124288499 15:28426348-28426370 CAGAAGCTGGGAGACCAGTTAGG + Intergenic
1124294727 15:28490966-28490988 CAGAAGCTGGGAGACCAGTTAGG - Intergenic
1124303244 15:28561065-28561087 GAGAAGATGGGGGAGCAGGAGGG + Intergenic
1124425375 15:29558483-29558505 CAGAAGATGGGTGACCGGCCGGG - Intronic
1127392346 15:58516485-58516507 CAGAACATCAGGGAGCTGTCGGG - Intronic
1128377537 15:67088224-67088246 CAGAAGATGGGTGCACAGTAGGG + Intronic
1128418851 15:67472481-67472503 CAGGAGATGGGGGAAGAGTAGGG + Intronic
1128801945 15:70502554-70502576 CAGAAGATGGTGGAGCTGCTGGG - Intergenic
1129075651 15:72993708-72993730 CAGAAGGTCTGGGATCAGTCCGG - Intergenic
1130894147 15:88157636-88157658 CAGAACATGGGGGAACAGTGGGG + Intronic
1130907130 15:88248621-88248643 CAGTAAATGGGAAAGCAGTCTGG - Intronic
1132566996 16:628120-628142 CAGAGGCCGGGGGAGCAGACAGG + Exonic
1132995108 16:2818650-2818672 CAGAAGAGAAGAGAGCAGTCAGG - Intronic
1133100400 16:3475905-3475927 CATAAGATGTGAGACCAGTCAGG + Intronic
1133618166 16:7499203-7499225 CAGAAGATAGGAGAGCAGCATGG - Intronic
1134124663 16:11608286-11608308 GAGAAGAACGGGGAGCAGTGAGG + Intronic
1134800129 16:17076719-17076741 CAAAAGATAGGAGAGCATTCTGG - Intergenic
1135125586 16:19806758-19806780 GAGGAGATGAGGAAGCAGTCAGG + Intronic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1135774912 16:25249120-25249142 CAGAAGCTGGGGGAGGAGGAGGG + Intronic
1136343877 16:29663147-29663169 CAGCAGCTGTGGGAGCAGGCGGG + Intronic
1137440783 16:48497167-48497189 CTGAAGCTGGGGCAGCAGCCGGG - Intergenic
1138248423 16:55484170-55484192 CAGAAGATGGGGCAGAAGAGGGG + Intronic
1138495618 16:57407343-57407365 AACTAGATGGGGGAGGAGTCAGG + Intronic
1138588772 16:57987943-57987965 CTGAAGGTGTGGGAGCAGGCTGG + Intronic
1140530395 16:75660760-75660782 CAGAAGATGGGGGAGGATGAAGG + Intronic
1140536500 16:75714667-75714689 CAGAAGATGGGGGAGGATGAAGG + Intronic
1140584102 16:76268173-76268195 CAGAAGATAGGGAAGCAGTGGGG + Intergenic
1141059977 16:80857943-80857965 GAGAAGAAGGGGGAGAAGTTTGG - Intergenic
1142333705 16:89472979-89473001 CAGAAGTTGGGAGACCAGCCTGG + Intronic
1142475542 17:186795-186817 CAGATGATGGAGGGGAAGTCAGG + Intergenic
1143658737 17:8312205-8312227 CAGAAGATGGGGGTGCACATTGG - Exonic
1143907856 17:10223884-10223906 CTGAAGATGTGGGAGGAGTGGGG + Intergenic
1144262774 17:13539092-13539114 CTGAAGATCTGGGAGCTGTCTGG + Intronic
1144877714 17:18411095-18411117 CAGAAGGTGGGGAAGAAGACTGG - Intergenic
1145154515 17:20533308-20533330 CAGAAGGTGGGGAAGAAGACTGG + Intergenic
1148586995 17:48788011-48788033 CAGAACATGGGGCTGCTGTCAGG + Intronic
1148698394 17:49574685-49574707 CAGATGGTGGGGGAGGAGGCTGG + Intergenic
1148743729 17:49907242-49907264 CAGAAGCTGAGGGAGCAGGTGGG + Intergenic
1149886531 17:60345623-60345645 CAGAAGATGGGTAAGAAATCAGG + Intronic
1150739685 17:67769376-67769398 CAGAAGTGGGGGGAGCAGACAGG - Intergenic
1151242213 17:72766993-72767015 GAGAAGTTGGGGGAGAAGTGGGG - Intronic
1151756088 17:76076070-76076092 CAGGAGGTGTGGGGGCAGTCTGG - Intronic
1152464126 17:80456271-80456293 GAGAAGGAGGGGAAGCAGTCTGG + Intergenic
1152649405 17:81484865-81484887 CAGGAGCTGGGGGAGCAGCCAGG + Intergenic
1154213374 18:12398141-12398163 CAGAGGATGGGGGACCAGTGAGG + Intergenic
1158264665 18:55648974-55648996 CAGAAAGTGGGGGAGCAGGAGGG - Intronic
1158297860 18:56018908-56018930 CAGAAGACTGGTGTGCAGTCTGG + Intergenic
1158714015 18:59862144-59862166 CACAAGATGAGGTTGCAGTCAGG - Intergenic
1159937198 18:74378645-74378667 CAGGAGCTGGGCCAGCAGTCAGG - Intergenic
1159973205 18:74678430-74678452 CAGAAAATGGGGTTGCAGGCAGG - Intronic
1161366675 19:3883938-3883960 CAGGGCAGGGGGGAGCAGTCTGG - Intronic
1161447604 19:4327231-4327253 GGGCAGATGGGGGAGCGGTCAGG + Intronic
1162736790 19:12751556-12751578 CAGAGGTTGGGGGAGGAGGCAGG - Intergenic
1162837332 19:13329332-13329354 TAGAAGGATGGGGAGCAGTCAGG - Intronic
1162882000 19:13666645-13666667 CAGAAGATGGGGGAAGTGTGAGG - Intergenic
1164816603 19:31208968-31208990 CTGAAGGTAGTGGAGCAGTCAGG + Intergenic
1165613043 19:37173419-37173441 CAGAGGAGGGAGGAGAAGTCCGG + Intronic
1165710841 19:38009772-38009794 AAGCAGATGGGGAAGCAGTGTGG - Intronic
1165867113 19:38945765-38945787 CAGAGCCTGGGGGAGGAGTCTGG + Intronic
1166768545 19:45266467-45266489 CAGCAGATGGGGGAGCGGATGGG + Intronic
1166882816 19:45939713-45939735 CAGAAGGGGAGGGTGCAGTCGGG + Exonic
1167055902 19:47111806-47111828 CAGAAGGTGGGGGTTCATTCAGG - Intronic
927487664 2:23499751-23499773 CAGGAGATGAGGGAGGAGTGGGG + Intronic
928913184 2:36443453-36443475 GAGAAGAGGGGTGAGTAGTCGGG - Intronic
929695823 2:44114387-44114409 CAAAAGAAGGGGGAGAAGACAGG - Intergenic
931239229 2:60437779-60437801 CAGAAGATTGGGGATGGGTCGGG - Intergenic
932834823 2:75026561-75026583 CAGAAGCAGGGAGACCAGTCAGG - Intergenic
933856557 2:86419866-86419888 CAGAAGTTGGGGGTCCAGTTAGG - Intergenic
934919005 2:98326809-98326831 CAGAAAATGGGGGAGGAATAGGG + Intergenic
935657468 2:105437107-105437129 AAGATGGTGGGTGAGCAGTCAGG + Intronic
935668636 2:105536288-105536310 CAGAAGCTGGGGGAGAGGTCTGG + Intergenic
936079379 2:109422014-109422036 AAGAGGATAGGTGAGCAGTCAGG - Intronic
936154713 2:110040373-110040395 CAGGGGATGGGGGGCCAGTCTGG + Intergenic
936189970 2:110331041-110331063 CAGGGGATGGGGGGCCAGTCTGG - Intergenic
936432848 2:112480123-112480145 CAGGAGTTGGGAGATCAGTCTGG + Intergenic
936956927 2:118031761-118031783 CAGAAGAGGAGGGAGCAGGAAGG + Intergenic
937317224 2:120939394-120939416 CAGGAGATTGGGGAGCACACGGG - Intronic
938072835 2:128317533-128317555 CAGAGGGTGGGGGAGCTGCCAGG - Intronic
938337950 2:130515770-130515792 CAGAACATTGGTGTGCAGTCTGG + Intergenic
938351889 2:130604968-130604990 CAGAACATTGGTGTGCAGTCTGG - Intergenic
938599091 2:132819132-132819154 CAGAGGGTTGGGGAGCAGTGAGG - Intronic
938939939 2:136161304-136161326 CCGAAGCTGGGAGAGCCGTCAGG + Intergenic
942721651 2:178959680-178959702 CAGGAGAAGCGGCAGCAGTCAGG + Intronic
945816346 2:214609508-214609530 CAGAAGAGGAGGGAGCAGGGTGG - Intergenic
947909510 2:233791919-233791941 CTGAAGATGGGGGTGCACTCAGG + Intronic
947990506 2:234484037-234484059 CAGAAGCTGGGGGAGAAGCCTGG + Intergenic
948560321 2:238847648-238847670 CAGAAGATGAGGACGCAGCCAGG - Intergenic
948662002 2:239513349-239513371 CAGGCGAAGGGGGAGCAGGCAGG - Intergenic
1174365783 20:50055367-50055389 CTGAAGCTGCAGGAGCAGTCCGG + Intergenic
1175176443 20:57115182-57115204 CTGGAGCTGGGGGAGCAGTGGGG + Intergenic
1175314019 20:58033333-58033355 CTAAAGAGGGTGGAGCAGTCTGG + Intergenic
1175414511 20:58792905-58792927 CTGATGATGGGGGAGAAGACGGG - Intergenic
1175414519 20:58792937-58792959 CTGATGATGGGGGAGAAGACGGG - Intergenic
1175414527 20:58792969-58792991 CTGATGATGGGGGAGAAGACGGG - Intergenic
1175414541 20:58793033-58793055 CTGATGATGGGGGAGAAGACGGG - Intergenic
1175414549 20:58793065-58793087 CTGATGATGGGGGAGAAGACGGG - Intergenic
1175891856 20:62319230-62319252 CAGAAGCTGGCTGAGCAGACTGG - Intronic
1176032817 20:63021880-63021902 CAGATGATGTGGGCGCAGGCGGG + Intergenic
1178630303 21:34253665-34253687 AAGAAGAATGGGGAGTAGTCAGG + Intergenic
1178777855 21:35569254-35569276 CAGAAGCTGGGGGAGAGGCCTGG + Intronic
1179545660 21:42111055-42111077 CAGAAGAGGGGGCAGCAATGTGG + Exonic
1179595641 21:42441446-42441468 CAGTTGATGGGGGAGGACTCGGG + Intronic
1180798793 22:18621688-18621710 CAGAAGCTGGGGGAGGAACCAGG - Intergenic
1180963410 22:19773237-19773259 CAGGAGGTGGCGGAGCAGGCAGG - Intronic
1181222923 22:21373574-21373596 CAGAAGCTGGGGGAGGAACCAGG + Intergenic
1181255818 22:21562046-21562068 CAGAAGCTGGGGGAGGAACCAGG - Intronic
1181457446 22:23067694-23067716 AAAAAGATGGAGGAGCAGTTGGG - Intronic
1181989069 22:26822793-26822815 CAAAAGCTGGGGGTCCAGTCAGG + Intergenic
1182828953 22:33289365-33289387 CAGGAGAGAGAGGAGCAGTCAGG - Intronic
1183285963 22:36964225-36964247 CAGAAGGTGGAGGAGCATGCAGG - Intergenic
1183650384 22:39150268-39150290 CAGCAGATGGGGGAGGAGCGTGG - Intronic
1185039104 22:48495385-48495407 AAGATGATGGGGGAGCAGCCTGG + Intronic
1185171294 22:49296094-49296116 GGGGAGATGGGGGAGCAGGCGGG + Intergenic
949782667 3:7707639-7707661 CAGAAGATGGTGGAGCCTTTAGG + Intronic
950482595 3:13253961-13253983 CAGAAGCTGGGGCCCCAGTCAGG - Intergenic
950696459 3:14704499-14704521 CAGAAGATGGGTGAGAGGTGGGG - Exonic
952425763 3:33173265-33173287 CAGCTGATGGGAGAGCAGACTGG + Intronic
953140731 3:40227092-40227114 GAGCAGAGGGGGAAGCAGTCAGG - Intronic
953407835 3:42668365-42668387 CAAGAGTTGGGGGAGCAGCCAGG - Intergenic
954569812 3:51631293-51631315 CAGAAGATGGGGGGACTTTCTGG + Intronic
955403301 3:58609022-58609044 CAGGAGTTGGGGGAGCTGGCAGG + Intronic
956446638 3:69332215-69332237 CAGAAGAGAAGGGAGCAGGCAGG + Intronic
956778618 3:72587166-72587188 CAGCAGATGGGGGAGCTGAAGGG - Intergenic
959498266 3:107076173-107076195 CAGTAGGTGGGGGAGTAGGCTGG - Intergenic
959920640 3:111864261-111864283 CAGATGATGGGAGAGGAGACAGG + Intronic
960242723 3:115364675-115364697 CAGGAGGTGAGGGAGCAGTGGGG + Intergenic
960724058 3:120652545-120652567 CAGAAGAGAGGAGAGCAGTAGGG + Intronic
962281250 3:134053642-134053664 CAGAAGGTGGGGTAGGACTCGGG - Intergenic
962531633 3:136286733-136286755 CAGAAGCAGGGAGACCAGTCAGG - Intronic
962546720 3:136443921-136443943 CAGAAAATGGGGGTGGAGTAAGG - Intronic
964210464 3:154221021-154221043 CAGAAGCTGGGGGAGAGGCCTGG + Intronic
964324843 3:155534610-155534632 CATGAGATGTGGGAGCAGCCAGG + Intronic
965811543 3:172595957-172595979 GAGAAGAGGGGTGAGGAGTCAGG + Intergenic
966647208 3:182259809-182259831 CAGCAGCTGGTGGAGGAGTCAGG + Intergenic
967697128 3:192544970-192544992 GAGGAGATGGAGGAGAAGTCAGG + Intronic
967988112 3:195111112-195111134 CAGAAGCTAGGGGAGCGGCCTGG - Intronic
968895254 4:3397149-3397171 AAGAAGGTGAGGGAGCAGCCTGG + Intronic
969572790 4:8019870-8019892 CAGGAGATGGGGCAGCAGCCAGG + Intronic
969595622 4:8147977-8147999 CAGAAGAAGGGGCACGAGTCAGG + Intronic
970576958 4:17437193-17437215 CAGCAGATGGGGGAGCCATAAGG + Intergenic
970609365 4:17710960-17710982 CAGAGGAGGGGGGTGAAGTCAGG + Intronic
974006266 4:56560316-56560338 AAGAAGATGGGAGAGAAGCCAGG - Intronic
974974993 4:68880872-68880894 CAGCAGATGGGGGAGCCAGCAGG + Intergenic
977097837 4:92768926-92768948 CATGAGATTTGGGAGCAGTCAGG - Intronic
979039380 4:115767180-115767202 GAGAAGATGGAAGAGCAGACTGG + Intergenic
981547838 4:145912725-145912747 CAGAAGCTGGGCGAGAGGTCTGG + Intronic
982209071 4:153020447-153020469 TAGAAGCTGGGGGATCATTCTGG - Intergenic
983275584 4:165613457-165613479 CAGAAGCTGGGGGAGAAACCTGG - Intergenic
985670068 5:1202406-1202428 CAGAGGAACGAGGAGCAGTCAGG - Intronic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
986059946 5:4178576-4178598 CAGAAGCTGGGAGAGAGGTCTGG + Intergenic
986593404 5:9394617-9394639 GAGGAGGTGGGGGAGCAGGCAGG + Intronic
986745254 5:10738039-10738061 CAGAAGCTAGGGGAGCAGCATGG + Intronic
986826891 5:11531971-11531993 CAGCAGCTGGGGGAACAGTTTGG - Intronic
987516871 5:18921217-18921239 CAGAAGATAGGAGAGAAGCCTGG - Intergenic
990245793 5:53862275-53862297 CAGAGTATAGGGGTGCAGTCTGG - Intergenic
990309421 5:54523877-54523899 CAGGAGAATGGGGAGCAGACAGG - Intronic
990637989 5:57750752-57750774 CAGCAGATGGGGGAGCTGGTAGG + Intergenic
990935039 5:61138951-61138973 CTGGAGCTTGGGGAGCAGTCAGG + Intronic
991592230 5:68265160-68265182 CAGGAGGTCGGGGTGCAGTCTGG - Intronic
993435910 5:87893932-87893954 AAGAAGATGGGGAAGCAGTTAGG - Intergenic
993680831 5:90875486-90875508 CAGAGGCTGTGGGAGCAGTATGG - Intronic
995159533 5:108962422-108962444 CAGAAGAAGGGGGAGCAAAAGGG - Intronic
995870513 5:116738953-116738975 GACAAGATGGGGGAGAAGGCAGG - Intergenic
995951234 5:117716265-117716287 GAGAACCTGGGGGAGCAGTGGGG + Intergenic
996647567 5:125834878-125834900 CAGAAGAAAAGGGAGCAGCCAGG + Intergenic
996844533 5:127884691-127884713 AAGAAGATGGGGAAGCTTTCTGG + Intergenic
998991439 5:147822068-147822090 AAGGTGAAGGGGGAGCAGTCAGG - Intergenic
1001717663 5:173829812-173829834 CAGGAGATGGGGGACAAGCCCGG - Intergenic
1001787387 5:174425561-174425583 CAGAAGCTCGGGGATCAGACAGG - Intergenic
1002063160 5:176638522-176638544 CTGTAGATAGGGTAGCAGTCAGG + Intronic
1002539163 5:179894517-179894539 CTGAAGATGCGGAAGCAGTTTGG - Exonic
1003226004 6:4206245-4206267 CAGAGCATGGGGGAGCAATGTGG + Intergenic
1005377441 6:25198090-25198112 AAGATGATGGTGGAGCAGGCAGG - Intergenic
1006870501 6:37246923-37246945 CAGAAGATGGGGAGACAGCCAGG + Intronic
1007394561 6:41570203-41570225 CAGAAGGTGTGGGATCAGACAGG - Intronic
1007634792 6:43292874-43292896 CAGGGGATGGGGGAGCAGCACGG + Intergenic
1007693931 6:43719763-43719785 CAGGAGATGCCGGAGGAGTCCGG - Intergenic
1007999933 6:46349790-46349812 GAGAAGCTGGGAGACCAGTCAGG - Intronic
1009999532 6:70934408-70934430 TACAGGATGGGTGAGCAGTCAGG - Intronic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1010823069 6:80439016-80439038 CAGAGGATGAGGGAGCAATTAGG - Intergenic
1012902001 6:105017393-105017415 CAGCAGATAGGGAAGCAGACTGG + Intronic
1014489417 6:122043800-122043822 CAGAAGATGGGGGTGGGATCAGG + Intergenic
1015333223 6:132005589-132005611 AAGAAGGTGGAGGAGCAGGCAGG + Intergenic
1016544150 6:145201780-145201802 CAGAAGGTGGGAGAGCATTGAGG + Intergenic
1017672178 6:156778497-156778519 CCCAAGATGGGGGAGCCGGCGGG + Exonic
1018021373 6:159764377-159764399 CAGAAGATGGGGGCACTCTCAGG - Intronic
1018342526 6:162867166-162867188 TAGAAGACTGGGGAGCATTCAGG - Intronic
1018420913 6:163640668-163640690 CAGAGGCTGGGGCAGCAGGCAGG - Intergenic
1018870441 6:167778514-167778536 CAGAAGAGGCTGGAGCAGGCAGG - Intergenic
1019254519 7:40784-40806 CAGGAGGCGGGGGAGGAGTCAGG - Intergenic
1019307304 7:341939-341961 CAGCAGGTGTGGCAGCAGTCAGG - Intergenic
1019666120 7:2253010-2253032 CAGGAGTTGGGGGAGCAGGAGGG - Exonic
1019843388 7:3472856-3472878 GAGAACATGGGGTAACAGTCAGG + Intronic
1021140088 7:17013449-17013471 CAGAGGATGGGAGAGCAGGGAGG + Intergenic
1023765255 7:43504560-43504582 CAGAAGTGGGGGAAGCAGACAGG - Intronic
1023854645 7:44175222-44175244 AAGAAGAAGGGGAAGCAGTTAGG - Intronic
1023892327 7:44401998-44402020 CAGAACATGAGGGAGGAGTGTGG - Intronic
1024047764 7:45596642-45596664 CAGAAGATGGGGGCTGAGTGAGG + Intronic
1024559128 7:50628641-50628663 CAGCAGACGGGGGACCAGCCAGG + Intronic
1025012183 7:55406380-55406402 CAGAAGATGGGGGAGCAGTCAGG + Intronic
1026008852 7:66621121-66621143 CAGAACATGGTGGTGCACTCCGG + Intergenic
1026082363 7:67233120-67233142 CAGATGATGGGTGAGCAAACTGG - Intronic
1026106952 7:67429015-67429037 CAAAAGATGGGGAGGCACTCAGG + Intergenic
1026694710 7:72580874-72580896 CAGATGATGGGTGAGCAAACTGG + Intronic
1027391321 7:77706417-77706439 CAGGAGTTGGGAGACCAGTCTGG - Intronic
1029042914 7:97596725-97596747 CAGAAGATGGGGTTCTAGTCTGG + Intergenic
1030845321 7:114401910-114401932 CAGAAGTTGGGAGACCAGCCTGG + Intronic
1031978324 7:128107741-128107763 CAGGGGATGAGGGAGCAGTATGG - Intergenic
1032469525 7:132168287-132168309 CAGGAGGTGAGGGTGCAGTCTGG - Exonic
1033291050 7:140082980-140083002 CAGGAGAGGAGGGAGCAGCCCGG + Intergenic
1034163656 7:149010035-149010057 CAGGGGATGGGGGGGCAGCCTGG + Intronic
1035367004 7:158355560-158355582 CAGGAGAGGCAGGAGCAGTCAGG + Intronic
1035718996 8:1776897-1776919 CAGAAGGGTGGGCAGCAGTCTGG + Intronic
1039058249 8:33553730-33553752 CAGAAGATGGGGGCACAGCCAGG + Intronic
1039400041 8:37261688-37261710 GAGAAGATGCGGGAGCAGCTGGG - Intergenic
1040514061 8:48120193-48120215 CAGGAGGAGAGGGAGCAGTCAGG + Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1047542609 8:125785037-125785059 CAGCAGATGGGGGAGCAAGAAGG - Intergenic
1048289475 8:133169610-133169632 CAAAGGATGGGGGAGGACTCAGG - Intergenic
1048427256 8:134334261-134334283 TAGAAGATAGGGGAGTAGCCTGG - Intergenic
1049229911 8:141476651-141476673 GAAAAAATGGGGGACCAGTCAGG - Intergenic
1050342483 9:4654636-4654658 CAGCAGATGGGGGAGCCAGCAGG + Intronic
1051388932 9:16542388-16542410 AAGAAGATGGGGGAGGGGACAGG + Intronic
1053195895 9:36118323-36118345 GAGGAGTTGGGGGAGCAGTGGGG - Intronic
1053234228 9:36438144-36438166 CAGAAGTTGGGAGACCAGCCTGG - Intronic
1056890474 9:90487413-90487435 GAGAAGATGGAGCAGCACTCTGG - Intergenic
1057386293 9:94608491-94608513 CAGAAGAATGGGAAGCAGTCAGG + Intronic
1057491971 9:95527472-95527494 CAGAAGTTAGGAGAGCAGCCTGG - Intergenic
1059450589 9:114369183-114369205 CAGTTGGTGAGGGAGCAGTCTGG + Intronic
1059473987 9:114529139-114529161 CAGAAGCAGAGGGAGCAGTGGGG + Intergenic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060426468 9:123510765-123510787 CAGAAGGTGGAGGAGCAGAAAGG + Intronic
1060816805 9:126639333-126639355 CAGATGATGGAGGGGCAGGCTGG - Intronic
1061167772 9:128934085-128934107 AAGAAGATCGGGGAACAGGCTGG + Intronic
1061373584 9:130211535-130211557 CAGAAGATGTGGAAGAAATCAGG + Intronic
1061590387 9:131594117-131594139 CAGCAGATGGGGGAGGGCTCTGG - Intronic
1062620210 9:137417157-137417179 CAGACGCCGGGGGAGAAGTCAGG + Intronic
1062745880 9:138211769-138211791 CAGGAGGCGGGGGAGGAGTCAGG + Intergenic
1185855900 X:3535009-3535031 AAGCAGATGAGGGAGCAGTGAGG + Intergenic
1187927613 X:24264301-24264323 GAGAAGATGGAAGAGCAGACTGG - Intergenic
1188519222 X:31019234-31019256 CAGAAGGTGAGGGAGCTCTCTGG - Intergenic
1189081325 X:37975639-37975661 TAGAAGCTGTGGAAGCAGTCAGG + Intronic
1189474035 X:41335046-41335068 CAGAAGATTGGGGAGGAGTGGGG + Intronic
1190133532 X:47772936-47772958 GAGAAGATGGGGGAGATGTCAGG + Intergenic
1190335663 X:49260240-49260262 CAGAAGCTGGGGGAGAGGCCTGG + Intronic
1190959026 X:55227250-55227272 CAGAAAATTGGGGAGGAGTGGGG + Intronic
1191881389 X:65846719-65846741 CAGAGGATGGGGGACAATTCAGG + Intergenic
1193283881 X:79688880-79688902 CAGGTCATTGGGGAGCAGTCTGG + Intergenic
1195329463 X:103785553-103785575 AAGAAGAAGGGGAAACAGTCAGG - Intronic
1195672574 X:107482260-107482282 GAGAAGGAGGGGGAGCAGGCTGG - Intergenic
1195839887 X:109163014-109163036 CAGAAGATGGGAAAGCTGTGAGG - Intergenic
1196883235 X:120219576-120219598 CAGAAGATGGGGGAGTGCTGAGG - Intergenic
1198025448 X:132701598-132701620 GAGAAGATGGGGAAGCAGGTGGG - Intronic
1198706160 X:139450706-139450728 CGGAAGATGGGAGAACAGTGGGG + Intergenic
1199573217 X:149288928-149288950 CACAAGATAGGGTAGCTGTCAGG + Intergenic
1199874558 X:151920289-151920311 GAGAAGCTGAGGGAGAAGTCGGG + Intronic
1199887010 X:152030244-152030266 CAGAAGCTGGGGAAACACTCGGG - Intergenic
1200393215 X:155965175-155965197 CTGAAGTGGGGGGGGCAGTCTGG + Intergenic
1201479036 Y:14417409-14417431 CAGAAATGGTGGGAGCAGTCAGG + Intergenic
1201730237 Y:17194139-17194161 CAAGAGATGGGGGAGGAGCCAGG - Intergenic