ID: 1025017420

View in Genome Browser
Species Human (GRCh38)
Location 7:55450152-55450174
Sequence TCGGTGACTCCAACTCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025017420_1025017432 20 Left 1025017420 7:55450152-55450174 CCCTTGGGAGTTGGAGTCACCGA 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1025017432 7:55450195-55450217 TCGGGCAGGAGACCTCAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 230
1025017420_1025017431 16 Left 1025017420 7:55450152-55450174 CCCTTGGGAGTTGGAGTCACCGA 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1025017431 7:55450191-55450213 CATTTCGGGCAGGAGACCTCAGG No data
1025017420_1025017430 6 Left 1025017420 7:55450152-55450174 CCCTTGGGAGTTGGAGTCACCGA 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1025017430 7:55450181-55450203 GCTGGGGGCACATTTCGGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 110
1025017420_1025017428 1 Left 1025017420 7:55450152-55450174 CCCTTGGGAGTTGGAGTCACCGA 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1025017428 7:55450176-55450198 TTGTGGCTGGGGGCACATTTCGG No data
1025017420_1025017425 -10 Left 1025017420 7:55450152-55450174 CCCTTGGGAGTTGGAGTCACCGA 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1025017425 7:55450165-55450187 GAGTCACCGACTTGTGGCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1025017420_1025017426 -9 Left 1025017420 7:55450152-55450174 CCCTTGGGAGTTGGAGTCACCGA 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1025017426 7:55450166-55450188 AGTCACCGACTTGTGGCTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 125
1025017420_1025017429 2 Left 1025017420 7:55450152-55450174 CCCTTGGGAGTTGGAGTCACCGA 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1025017429 7:55450177-55450199 TGTGGCTGGGGGCACATTTCGGG 0: 1
1: 0
2: 0
3: 25
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025017420 Original CRISPR TCGGTGACTCCAACTCCCAA GGG (reversed) Intronic
905544679 1:38788136-38788158 TCTGTGCCTCCAACCCCCATGGG + Intergenic
905979487 1:42210907-42210929 TCAGGGACTGCTACTCCCAAGGG + Intronic
908013165 1:59803941-59803963 TCTGTGACTTCTACTACCAAAGG - Intergenic
913654123 1:120945077-120945099 TGGGGGACTCCAACGGCCAAAGG - Intergenic
914519806 1:148405172-148405194 TGGGGGACTCCAACGGCCAAAGG - Intergenic
914644319 1:149639241-149639263 TGGGGGACTCCAACGGCCAAAGG - Intergenic
917611080 1:176689683-176689705 TCCTTGACTCCAAATCCCATGGG + Intronic
924820747 1:247487895-247487917 TAGATGACTCCAAATCCCCAAGG + Intergenic
1062982785 10:1739273-1739295 TCGGTGACTCCACCCCCTGATGG - Intergenic
1066449223 10:35512763-35512785 TCTGTGACTCAAACTCCCTGTGG + Intronic
1076214786 10:128684800-128684822 TCGGTGACCTGAACTGCCAATGG + Intergenic
1076657310 10:132033295-132033317 GCTGTGAGTCCAACTCCCAGGGG + Intergenic
1077791852 11:5449622-5449644 TCTGTGACTCCAAGTTTCAAAGG + Intronic
1088783861 11:113163198-113163220 ACCCTGACTCCAATTCCCAAAGG - Intronic
1090437495 11:126698760-126698782 TGAGTGACTCCAACTGCCATTGG + Intronic
1097856830 12:64472296-64472318 TCTGTGACTCTCACTCCCAAAGG - Intronic
1103592169 12:121999873-121999895 TCGGTTATACCAACTCCAAAGGG + Exonic
1108595310 13:51944122-51944144 TTGGTGACTGCCACGCCCAAGGG + Exonic
1110844806 13:80182068-80182090 TCTGGGACTCCAACTACAAATGG + Intergenic
1135064857 16:19300845-19300867 TCCATGGCTCCAACTCCCATAGG - Intronic
1136158775 16:28403888-28403910 TGGGAGACTACAACTCCCAGTGG + Intergenic
1136204313 16:28711395-28711417 TGGGAGACTACAACTCCCAGTGG - Exonic
1141143953 16:81515925-81515947 TCCGTGGCTCCAGCTCCCACTGG + Intronic
1141993621 16:87623610-87623632 TCGGGGTCTGCAGCTCCCAAGGG - Intronic
1146956491 17:36939039-36939061 CAGGTGACTCCGACTCCCACGGG + Intronic
1149098843 17:52878937-52878959 TCAGTTGCTCCAACTTCCAACGG - Intronic
1150470660 17:65434603-65434625 GTGGTGACTCCCACTTCCAAAGG + Intergenic
1151294641 17:73175902-73175924 TCAGTGACTCCCACTGCAAAGGG - Intergenic
1203166274 17_GL000205v2_random:99689-99711 TCCATGAATCCAACTTCCAATGG - Intergenic
1154379224 18:13834911-13834933 TGGGTGACTCCTACTCACAGAGG - Intergenic
1155537709 18:26834014-26834036 ACGGTGCCTCCAATGCCCAAGGG - Intergenic
1157478422 18:48037691-48037713 CTGGTGACTCCAATTCCAAAAGG - Intronic
1157764237 18:50285305-50285327 TCGGTGAGTCCAGCCCCCCAGGG - Exonic
1158773095 18:60544962-60544984 TGGGTGACTACAACCCTCAAAGG - Intergenic
926104396 2:10141360-10141382 TAGGTGGCACCAACTCCCTAAGG - Exonic
926401849 2:12505084-12505106 AAGGTGACTCCAACTCACCATGG + Intergenic
928480154 2:31675289-31675311 TCAGGGACTCCTACTCCTAAGGG - Intergenic
929780876 2:44956025-44956047 AAGGTGACTCCAAATCCCACAGG - Intergenic
932185706 2:69693703-69693725 TCTGTGACACCCACTCCCAGGGG + Intronic
935268773 2:101416031-101416053 TCCCTGTCTCCATCTCCCAAGGG - Intronic
937790396 2:125954296-125954318 TCTGTCACTTCCACTCCCAATGG - Intergenic
938181991 2:129192058-129192080 TCGGTGGCTCCAGCACCCGAGGG - Intergenic
943720676 2:191200307-191200329 CCGGTGATTCCTAGTCCCAAAGG + Intergenic
944540693 2:200750672-200750694 TCGGCGCTTCCACCTCCCAAAGG - Intergenic
947272397 2:228351819-228351841 TCTGTGGCTCTAACTCCCAATGG - Intergenic
948932662 2:241142035-241142057 TGGGTGAAGCCCACTCCCAAGGG + Intronic
1172091996 20:32439581-32439603 TTTGTGACTCGCACTCCCAAGGG - Intergenic
1172128947 20:32643040-32643062 TCTGTGACTCCATTTCACAAGGG - Intergenic
1175660750 20:60810029-60810051 TTGGTCACTCCAAATGCCAATGG + Intergenic
1176405481 21:6359407-6359429 TCCATGAATCCAACTTCCAATGG + Intergenic
1179055209 21:37925530-37925552 TAGGTGACTCCAACTTTCATTGG + Intergenic
1180082072 21:45491504-45491526 TCGGTGTCTCCAACACCACATGG - Intronic
1183212973 22:36462336-36462358 TCACTGCCTCCAACTCCCTAGGG + Intergenic
970686113 4:18569357-18569379 TCTGTGCCTGAAACTCCCAAAGG - Intergenic
972949277 4:44299170-44299192 TAGGTAACTCCATCACCCAAAGG + Intronic
980098025 4:128513064-128513086 TCCCTGACTCCAGCTCCCACTGG + Intergenic
980213281 4:129817599-129817621 TGGGTGACTCAATCTCCAAATGG + Intergenic
980591428 4:134894419-134894441 TCCCTGCCTCCACCTCCCAAAGG + Intergenic
1003047123 6:2744134-2744156 TCGGTGACACCCACTCCTCAGGG - Intronic
1005983459 6:30855166-30855188 TGGGTTACTCCAATTCCCCAAGG + Intergenic
1008782742 6:55127005-55127027 TCGGTGGGTCCCACTCCCATAGG - Intronic
1009964903 6:70567362-70567384 TCAATGACTCCCATTCCCAAAGG - Intronic
1011997991 6:93617710-93617732 ATTGTGACTCTAACTCCCAATGG + Intergenic
1017647533 6:156552785-156552807 TCTGTGATTCTAACTCCCACTGG + Intergenic
1025017420 7:55450152-55450174 TCGGTGACTCCAACTCCCAAGGG - Intronic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1034509118 7:151519977-151519999 TCGGAAACTCCATCTCCCATTGG + Intronic
1047256775 8:123219512-123219534 TCTCTGCCTCCAAGTCCCAAGGG - Intergenic
1047294109 8:123556130-123556152 TTGGTTACTGCAAATCCCAAAGG - Intergenic
1053408869 9:37902889-37902911 AGGGTGACTCCAATTCTCAAAGG + Intronic
1058756826 9:108090284-108090306 AGTGTGACTCCAGCTCCCAATGG - Intergenic
1059841688 9:118224312-118224334 TCTGTGGCTCCAACTCCCAATGG + Intergenic
1060966973 9:127716892-127716914 TGGGTGATTCCAGCCCCCAAAGG + Exonic
1203439863 Un_GL000195v1:179012-179034 TCCATGAATCCAACTTCCAATGG + Intergenic
1191616769 X:63177587-63177609 TCAGTGACTCCCACTCCTACGGG + Intergenic
1191619528 X:63201336-63201358 TCAGTGACTCCCACTCCTACGGG - Intergenic
1191693114 X:63961051-63961073 TCTGTGCCTCCAACTCCCAGAGG - Intergenic
1195275254 X:103275223-103275245 TAAGTTACTCCTACTCCCAAGGG + Intronic
1202037990 Y:20654749-20654771 TCCATGACTACAACTCACAAGGG + Intergenic