ID: 1025019413

View in Genome Browser
Species Human (GRCh38)
Location 7:55468776-55468798
Sequence GCCCCAGGGTACCACGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025019408_1025019413 -6 Left 1025019408 7:55468759-55468781 CCTAAGGGAGGAGTGAAGCCCCA 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1025019413 7:55468776-55468798 GCCCCAGGGTACCACGGGACAGG No data
1025019403_1025019413 17 Left 1025019403 7:55468736-55468758 CCAATGTGGAGATAGGTCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 114
Right 1025019413 7:55468776-55468798 GCCCCAGGGTACCACGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025019413 Original CRISPR GCCCCAGGGTACCACGGGAC AGG Intronic
No off target data available for this crispr