ID: 1025020779

View in Genome Browser
Species Human (GRCh38)
Location 7:55477520-55477542
Sequence CCTCACCTGCAGCAGGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025020779_1025020793 19 Left 1025020779 7:55477520-55477542 CCAACCCCCTGCTGCAGGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 340
Right 1025020793 7:55477562-55477584 TTTGTAGAAGAGAGGCAGCCAGG 0: 1
1: 0
2: 2
3: 34
4: 252
1025020779_1025020792 11 Left 1025020779 7:55477520-55477542 CCAACCCCCTGCTGCAGGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 340
Right 1025020792 7:55477554-55477576 GTGTGGTCTTTGTAGAAGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 186
1025020779_1025020791 -6 Left 1025020779 7:55477520-55477542 CCAACCCCCTGCTGCAGGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 340
Right 1025020791 7:55477537-55477559 GTGAGGGAGGGGCGGGAGTGTGG 0: 1
1: 1
2: 14
3: 215
4: 2148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025020779 Original CRISPR CCTCACCTGCAGCAGGGGGT TGG (reversed) Intronic
900781969 1:4624296-4624318 CCTCCCCTGCAGCAGGGAGGAGG - Intergenic
900946157 1:5832425-5832447 CCTTCCCTGGAGAAGGGGGTTGG - Intergenic
900974391 1:6008078-6008100 CCTCACCTGCACCAATGGGGAGG + Intronic
901431277 1:9216454-9216476 CCCCACCAGGAGCTGGGGGTGGG + Intergenic
901700889 1:11044349-11044371 CCCCCACTGCAGCTGGGGGTGGG - Intronic
901843186 1:11966347-11966369 CCTTGCCTGCTGCAGGGGGCAGG + Intronic
902035639 1:13456145-13456167 CCTCACCTGCTGCTGGGAGTCGG - Intergenic
902276991 1:15347011-15347033 TTTCTCCTGCAGCAGTGGGTGGG - Intronic
902816936 1:18921900-18921922 CCTTAACTGCAGGAAGGGGTGGG + Intronic
903032685 1:20475175-20475197 CCTCCCCTGGAGTTGGGGGTGGG - Intergenic
903069001 1:20717470-20717492 CCTCACCTCCACCAGCGGATAGG + Exonic
903149690 1:21397985-21398007 CCTCTCCTGAGGCAGGGGCTGGG + Intergenic
903570018 1:24297439-24297461 CCTCACCTTGAGCAAGGGGAGGG + Intergenic
903668535 1:25022319-25022341 CCTCGCCCACAGCAGGGGGTGGG - Intergenic
903808915 1:26023546-26023568 CCTCAGCTGCAGCAGCAGGAGGG + Intronic
904043622 1:27598106-27598128 CCTCTCCTGGCTCAGGGGGTGGG + Intronic
904408639 1:30311562-30311584 CCTCGCCTGCAGCATGCGGGGGG + Intergenic
904577182 1:31512562-31512584 GGTGACCTGCGGCAGGGGGTTGG - Intergenic
904773916 1:32895335-32895357 CCTCAGCTCCAGCAGCTGGTGGG + Exonic
904856262 1:33500246-33500268 ACTCAGCTGCAGCATGGGGTGGG - Intergenic
905199537 1:36306739-36306761 CCTCACCTGCACCAGGCGCTCGG - Exonic
905276144 1:36819451-36819473 CCTCAGCTGGAGCAGGAGGTGGG + Intronic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905370625 1:37480828-37480850 CCTCATCTGAAACATGGGGTCGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905925578 1:41747129-41747151 TCTCTCCTGCAGCAGGTGTTTGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906284093 1:44574746-44574768 CCTGACCTCCAGCCCGGGGTGGG + Intronic
909169934 1:72282541-72282563 ACTCGCCAGCACCAGGGGGTGGG - Exonic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
912551540 1:110488391-110488413 CCTCATCTGAAGCGTGGGGTAGG + Intergenic
912583186 1:110738125-110738147 CCTCACCTGCAGGAGATGGGAGG - Intergenic
912963381 1:114215930-114215952 CCTCTCCTGCAGGAGGAGATAGG - Intergenic
914847957 1:151293219-151293241 CCTCACCTACAGAAGGGCTTAGG - Intronic
915307793 1:154990590-154990612 GCTCACCTGCAGTAGTGGGGAGG + Intronic
916198848 1:162250627-162250649 CCTCAACTGCTGCATGGGGGTGG - Intronic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
917345208 1:174022254-174022276 CCTCAGCAGCAGCAGGTGGGAGG - Exonic
917742630 1:177975868-177975890 GCTCACCTGAAGCAAGGGGCTGG - Intronic
920032291 1:203044699-203044721 TCTGCCCTGCAGCAGGGGGCAGG + Intronic
920268888 1:204747900-204747922 CATCTCCTGCAGCTGGAGGTTGG - Intergenic
920336941 1:205251213-205251235 CCTGAGCTGCAGTAGGGAGTTGG + Intronic
920535204 1:206732651-206732673 CCTCTTCAGCAGCAGAGGGTTGG - Exonic
922377268 1:224980827-224980849 CCCCACATGGAGCTGGGGGTGGG - Intronic
922621845 1:226994718-226994740 CCTCAGCTGCAGCAGGGTTCGGG - Intronic
922804313 1:228377738-228377760 CCTCACCTGGGGCGGGGGGCAGG + Intronic
1062810509 10:459928-459950 GCTCACGTGCAGCAGGTGGTTGG - Intronic
1062917963 10:1256364-1256386 CATGACCTGCAGCAGCGGGTGGG + Intronic
1063520477 10:6736405-6736427 CCTCACCTGCAACATAGGGCAGG - Intergenic
1063695548 10:8331711-8331733 CCTCACCTGTTCGAGGGGGTCGG - Intergenic
1065948110 10:30625859-30625881 CCTCCCCTAAAGCAGGGGGATGG - Intronic
1066382445 10:34912909-34912931 CCTCACATGAGGCAGGTGGTCGG - Intergenic
1067158562 10:43803151-43803173 CCTCACATGGAGCAAGGGGCCGG + Intergenic
1067764048 10:49071815-49071837 CCACACATGCAGGAGGGGTTGGG + Intronic
1069604758 10:69732206-69732228 CCTCAGCTGCACCATGGGTTTGG - Intergenic
1069894430 10:71671817-71671839 CCTCACTTGCAAAAGTGGGTGGG + Intronic
1070310460 10:75269817-75269839 CCTCCCTTGCAGCTGGGGGAGGG - Intergenic
1070673042 10:78391560-78391582 CCTGGCCTGCAGGAGGTGGTGGG + Intergenic
1070754304 10:78982116-78982138 CCTCACATGCTGCAGGGAGGTGG + Intergenic
1071966872 10:90860401-90860423 CCTCACCTGGCAAAGGGGGTAGG + Intergenic
1073288049 10:102400178-102400200 CCGCACCTGGTGCAGGTGGTTGG - Exonic
1075061280 10:119258746-119258768 CCCCACCTCCAGCAGGGGAGTGG + Intronic
1075182762 10:120226631-120226653 GCTCCCCTGCAGCAGAGGTTTGG + Intergenic
1075802102 10:125160252-125160274 CCTCACCTGCGGCCGCGGGCTGG - Intronic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1076484994 10:130810193-130810215 ACTCTCCTGCAGCAGGGACTAGG + Intergenic
1076574415 10:131454174-131454196 GCTTGCCTGCAGCAGGGGGCAGG - Intergenic
1077285372 11:1763151-1763173 CCTCACCTGGCACAGGGGATCGG + Intronic
1077343180 11:2035080-2035102 CCCCGCCTGCGGCAGAGGGTGGG - Intergenic
1077680229 11:4233230-4233252 CCTCAGCTGCTGCAGGGTCTCGG - Intergenic
1077681255 11:4242676-4242698 CCTCAGCTGCTGCAGGGTCTCGG + Intergenic
1077684508 11:4278649-4278671 CCTCAGCTGCTGCAGGGACTCGG - Intergenic
1077685533 11:4288119-4288141 CCTCAGCTGCTGCAGGGACTCGG + Intergenic
1077690686 11:4339280-4339302 CCTCAGCTGCTGCAGGGACTCGG + Intergenic
1079029897 11:16978906-16978928 CCTGAACTGCAGCAGGGTGTGGG - Intronic
1079078272 11:17396879-17396901 CCTGTCCTGCAGCATTGGGTTGG + Intronic
1080750078 11:35143010-35143032 CCCCACCCACTGCAGGGGGTGGG - Intronic
1080873502 11:36257364-36257386 TATCACCTGGGGCAGGGGGTGGG + Intergenic
1083166711 11:60892978-60893000 CCTGAACTGCAGAAGGGAGTAGG - Intronic
1084640115 11:70420756-70420778 CCAAGCCTGCAGCAGGGGGCTGG + Intronic
1084913707 11:72411828-72411850 CCTCAGCTGCAGCTGGGGAGGGG + Intronic
1085079983 11:73625893-73625915 TCTCGCCTGCGGCAGGGGTTTGG + Intergenic
1085296581 11:75434923-75434945 CCGCTCCTGGGGCAGGGGGTTGG + Exonic
1085520907 11:77138401-77138423 CCTCACCGGCAGGACGGCGTAGG - Intronic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1088893264 11:114060461-114060483 CCTCCCCTGCAAAAGGGGGGTGG - Intronic
1089297888 11:117480873-117480895 CCACACCTGCTGCAGGGGCCTGG + Intronic
1089822643 11:121241857-121241879 CCAGGCCTGCAGCCGGGGGTCGG + Intergenic
1091006382 11:131957402-131957424 CTGCACCTGCAGGAGGGAGTTGG - Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1202826166 11_KI270721v1_random:90269-90291 CCCCGCCTGCGGCAGAGGGTGGG - Intergenic
1091768621 12:3137644-3137666 ACGCAGCTGGAGCAGGGGGTGGG - Intronic
1091981918 12:4871512-4871534 CATCAGCTTCAGCAGGGGTTGGG + Intergenic
1092880131 12:12881782-12881804 CCTGGCCTGCGGCAGGGGGGCGG - Intergenic
1092903933 12:13085206-13085228 CTTCACCTGCTGCATGGCGTCGG - Exonic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098987447 12:77028030-77028052 TCTCTTCTGCAGCAGGGAGTTGG + Exonic
1102861818 12:116342609-116342631 CCTCCCTTGCAGCAAGGGATGGG + Intergenic
1103261511 12:119593220-119593242 CCCCACCTGGGGGAGGGGGTCGG + Intergenic
1104015622 12:124959931-124959953 CCTGCCCTGGAGCAGGGGGAGGG + Intronic
1104378733 12:128288442-128288464 CCTCCCCTGCAGCTGGGTCTGGG + Intronic
1104631395 12:130405657-130405679 AATCACCAGCAGCAAGGGGTGGG + Intronic
1104831681 12:131756729-131756751 CCTCACCTGCAGGCTGGGGTGGG + Intronic
1105019687 12:132807883-132807905 CAGCATCTGCAGCAGGTGGTGGG - Exonic
1105286665 13:19009639-19009661 TGTCTCCTGCAGTAGGGGGTGGG + Intergenic
1105410554 13:20168045-20168067 CCTCACCTTCAGCGGGGGCTGGG + Intergenic
1113244354 13:108377705-108377727 CCTCCCCTGAAGCTGGGGGAAGG + Intergenic
1114050502 14:18916758-18916780 CCTCACCCGAAACAAGGGGTGGG + Intergenic
1114069612 14:19097062-19097084 CATCACCTGCTGGAGGGAGTGGG + Intergenic
1114112055 14:19485174-19485196 CCTCACCCGAAACAAGGGGTGGG - Intergenic
1115247682 14:31312962-31312984 CCTTACCTTCAGCAGGAAGTTGG + Exonic
1117194348 14:53324533-53324555 CTGCACCTGCAGCAGTGTGTGGG - Intergenic
1121545922 14:94763630-94763652 CCTCACCTGCAAAATGGGCTTGG - Intergenic
1121850555 14:97218478-97218500 CATCACCAGCAGCAGGTGTTTGG - Intergenic
1122038302 14:98964333-98964355 CATCTCCTGCAGCACAGGGTGGG - Intergenic
1122157634 14:99759757-99759779 CCTCAGCAGCAGCAGGGCCTGGG + Intronic
1122313134 14:100809943-100809965 CCTGATCTGCAGCTGGGGCTTGG + Intergenic
1122359303 14:101150216-101150238 CCACACCTGCAGCGGAGGGCAGG - Intergenic
1122692606 14:103538346-103538368 CCTCACCAGCCACAGAGGGTGGG + Intergenic
1122728540 14:103777555-103777577 CCTCTCCTGGAGCAGGCAGTGGG - Intronic
1124187396 15:27542328-27542350 CCACACCTGCAGCTGGGGAGTGG + Intergenic
1124439281 15:29675039-29675061 CCAGAGCTGCAGCAGGAGGTCGG - Intergenic
1124586559 15:31014982-31015004 CCTGACTTGAGGCAGGGGGTGGG + Intronic
1125207247 15:37167609-37167631 CCTCTCCTGCAGCAAAGGCTGGG + Intergenic
1125389180 15:39173109-39173131 GCTCAACTGCTGCACGGGGTGGG - Intergenic
1127060921 15:55183309-55183331 ACTCACCTGCAAGAGGGGCTCGG + Exonic
1128323392 15:66707560-66707582 CCTCACCTCCAGGAGGAGCTAGG - Intronic
1128988743 15:72241110-72241132 CCTCACAAGGGGCAGGGGGTGGG - Intergenic
1128989777 15:72250014-72250036 CCTCACCTGCAGTTTGGTGTAGG + Exonic
1129870266 15:78935565-78935587 CCTCAGCTGCATCTGGGGATGGG + Intronic
1129917041 15:79283112-79283134 CCCTACCTGCAGCTGCGGGTTGG - Intergenic
1130020651 15:80228560-80228582 CCTCACCTTTAGCAGGGTGCAGG + Intergenic
1131072429 15:89474660-89474682 CCTCAACTGCTGAAAGGGGTGGG + Intronic
1131270187 15:90942519-90942541 CATAACCTGCAGCAGGTGGCAGG - Exonic
1132571556 16:646592-646614 CCGCACCTACAGCCGGAGGTGGG - Intronic
1132694724 16:1196798-1196820 ACCCACCTGCATCAGGGGATGGG + Intronic
1132709868 16:1261672-1261694 ACTCGCCTGCTGCAGGCGGTAGG + Intergenic
1133043251 16:3072083-3072105 CATCAGCTTCAGCAGGGGGCAGG + Intronic
1133286368 16:4692676-4692698 CCTCACCAGCAGCAGGGCCCAGG - Intergenic
1133784329 16:8963303-8963325 CCTCGCCTGCGGCCGGGGGCCGG + Exonic
1133932298 16:10242374-10242396 CATGACCTGCAGCAGGCGGCTGG + Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1135537206 16:23303277-23303299 ACTCACCTCCACCAGGGAGTAGG + Intronic
1136621159 16:31429262-31429284 CCCCAGCTGCAGGAGGGGATGGG + Intergenic
1138421887 16:56904390-56904412 CCTCACCTGCCGAAGGGACTGGG - Exonic
1139917595 16:70438232-70438254 CCAGAGCTGTAGCAGGGGGTGGG + Intronic
1140756781 16:78074741-78074763 CCTCACCTGAAGCAGGAGAAGGG + Intergenic
1140833365 16:78771313-78771335 CCTCAACAGAAGCTGGGGGTTGG - Intronic
1141507642 16:84489312-84489334 CAGCACCTGCACCCGGGGGTTGG + Exonic
1141981016 16:87550616-87550638 CCCCGCCTGCAAAAGGGGGTGGG - Intergenic
1142178412 16:88655650-88655672 CCTTACCCGAAGCAGGGGGCTGG + Exonic
1142288074 16:89179558-89179580 GCTCACCTGAACCAGGGGGTAGG - Exonic
1142933416 17:3307839-3307861 CCTGGCCTGCAGCATGGGGCTGG - Intergenic
1143354308 17:6314075-6314097 TCTCCCCTGCAGCAGGTGGGTGG - Intergenic
1143374436 17:6458933-6458955 AGTCACCTGCAGGATGGGGTAGG - Intronic
1144686346 17:17228617-17228639 GCTTACCTCCTGCAGGGGGTCGG + Intronic
1145009230 17:19358014-19358036 CCTTACCTTCAGCAGGCAGTTGG + Intronic
1146277304 17:31523876-31523898 GCTTACCTGCAGCAGGGGGCCGG - Exonic
1147629920 17:41923520-41923542 ACTCACCTGCAGCAGGTTGCAGG - Intronic
1148088438 17:45008283-45008305 CCTCACCTGCAGCTGGGGGACGG + Intergenic
1148859550 17:50596866-50596888 CCGCACCAGCAGCAGCGGGTCGG + Exonic
1149256572 17:54834323-54834345 CCTTCCTTGCAGCAGGGCGTGGG + Intergenic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1151388162 17:73768022-73768044 CCCCAGCTGCATCTGGGGGTTGG - Intergenic
1151719540 17:75847481-75847503 CCTCACCTGCAGGAGTGGAGGGG + Exonic
1152088934 17:78236497-78236519 TCTCACCTGCAGCTGGGACTGGG - Intronic
1152312753 17:79560850-79560872 TCTCAGCTGCCCCAGGGGGTAGG + Intergenic
1152634880 17:81426852-81426874 CCTCACCAGCAGCCTGGGCTCGG + Exonic
1152755613 17:82085797-82085819 GCTCAGCTGCAGCAGGGGATGGG + Exonic
1152756440 17:82088963-82088985 GCCTACCTGCAGCAGGGCGTGGG + Exonic
1154325753 18:13389372-13389394 CCTCCCCTCCAGGTGGGGGTGGG + Intronic
1155135434 18:22987190-22987212 CCTCTCTTGCAGGTGGGGGTTGG - Intronic
1156462084 18:37326757-37326779 TCCCACCTGCGGCAGGGGGTGGG + Intronic
1158945341 18:62442705-62442727 GCTCTTCTCCAGCAGGGGGTTGG - Intergenic
1159007000 18:63022353-63022375 CGTCACCTGGAGCAGGTGCTTGG - Intergenic
1159037616 18:63292910-63292932 CATCACCTGCAGCAGCAGGAAGG - Intronic
1160187014 18:76683874-76683896 CCTCACGTGCAGCCCGGGATGGG - Intergenic
1160440274 18:78884268-78884290 GCTCACCTGGATCAGGGGGCTGG + Intergenic
1161086677 19:2338701-2338723 CATCACCCGCAGCAGTGGGTGGG - Intronic
1161315241 19:3614584-3614606 GCTCACCTGCAGCGGGGTGGGGG + Exonic
1161383655 19:3979802-3979824 GCCCACCTGCACCATGGGGTCGG + Exonic
1162340985 19:10091498-10091520 CCGCACCCGTAGCAGGGGGACGG - Exonic
1163250348 19:16123000-16123022 CCTCCCCTGCACCAGGCAGTGGG + Intronic
1164614388 19:29657819-29657841 CCTCACCCCTAGCAAGGGGTTGG + Intergenic
1164952214 19:32345975-32345997 CTTGCCCTGCAGCTGGGGGTGGG + Intronic
1165074640 19:33273924-33273946 CCTCTCCTGCAGCAGGGCCACGG + Intergenic
1165745220 19:38226604-38226626 CCTCTCCTGGAACAGGAGGTAGG + Intronic
1166528364 19:43527091-43527113 CCGCACCTGCCGCAGGAGGATGG + Exonic
1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG + Exonic
1167049084 19:47067756-47067778 CCCCAACTGAAGCCGGGGGTCGG + Exonic
1167209248 19:48122784-48122806 ACTCAGTTGCAGCAGGGGGCTGG + Intronic
1167381848 19:49142792-49142814 CCTCCGCTGCAGCTGTGGGTGGG + Exonic
1167446798 19:49542718-49542740 GCTCTCGTGCAGCAGGTGGTTGG - Exonic
1168354258 19:55692002-55692024 CCTCCCCAGCTGCAGGGGCTGGG - Exonic
925892934 2:8450605-8450627 CCTCTCATGCTGCAGGGGGCAGG + Intergenic
925912942 2:8584863-8584885 CTTCACCTGCAGGAGGAGCTGGG - Intergenic
926589465 2:14724579-14724601 CCTCACCTGGAACAGAGGGAGGG + Intergenic
926707480 2:15846959-15846981 CCTCACCTGCTGCAGGGTGGAGG + Intergenic
926956971 2:18312361-18312383 CCACACCTGCTACAGGGGCTGGG - Intronic
927846593 2:26475488-26475510 CAGCACCTGCAGCATGGGATGGG + Exonic
929785765 2:44990031-44990053 CCTCCCCTGAAGCTGGGGCTGGG + Intergenic
929814492 2:45220300-45220322 CACCCCCTGCAGCCGGGGGTGGG - Intergenic
929868341 2:45737089-45737111 TCTCCCCTGCAGCATGGGGTTGG + Intronic
930110560 2:47675375-47675397 GCTCAGCTGCCGGAGGGGGTTGG - Intergenic
931694129 2:64859560-64859582 CCTCATCTGTAGCTGGGGCTGGG - Intergenic
935304316 2:101721968-101721990 CATCAGCTGCAGCAGGAGTTAGG - Intronic
935507579 2:103925353-103925375 CCTGGCCTGCAGCATGGGGCTGG + Intergenic
937858053 2:126686917-126686939 CCTCAGCTCCAGCAAGGGGCAGG + Intronic
938619125 2:133031241-133031263 CCTCTGCTGCTGCTGGGGGTAGG - Intronic
938776387 2:134544978-134545000 CCTCCCCTCCAGGAGGGGGCTGG - Intronic
941034322 2:160551128-160551150 CCTCACCAGCAACATGGGGATGG + Intergenic
942564630 2:177254324-177254346 CCTAACCTGAAGCAGGTGATGGG - Intronic
944118486 2:196214199-196214221 ACTTACCTGCAGCAGGGTCTTGG - Intronic
946381663 2:219353003-219353025 CCTTACCTGGAGCAGGGCCTTGG + Intergenic
947385165 2:229584273-229584295 CCTCACCTGGAGGATGGGGTAGG - Intronic
947402314 2:229742827-229742849 CCTCACCTCCCGGATGGGGTCGG - Intergenic
947980579 2:234405318-234405340 CCTCACCTGCAGCTGGCTGGAGG - Intergenic
948483964 2:238268278-238268300 CATCACCTGCAGCATGGCATGGG - Intronic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
1172011222 20:31846979-31847001 CCCCAGCTGCAGCCTGGGGTCGG + Intergenic
1172013952 20:31862063-31862085 GCTCATCTGCAGCACGGCGTTGG - Intronic
1172321266 20:33996961-33996983 CCTCACCTGCAGCAGAGATGTGG + Intronic
1172513414 20:35515899-35515921 CCTCACCTCCAGCAGGGTAGAGG - Exonic
1173302384 20:41815650-41815672 CCTTACATGCTGCAGGGTGTTGG + Intergenic
1173955995 20:47033114-47033136 GCTCACCTGCAGCAGCAGCTGGG - Intronic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175638099 20:60602446-60602468 TATTACCTGCAGCAGAGGGTGGG + Intergenic
1175743466 20:61436726-61436748 CCTGACCTCCAGATGGGGGTGGG - Intronic
1175801616 20:61804289-61804311 CCTCACCTGCACCATGTGGCTGG - Intronic
1175811957 20:61863273-61863295 CCTCACCTGCAGCCGGGGCGGGG + Intronic
1175876549 20:62232905-62232927 CCTCAGCTGGAGCTGGGGATGGG - Intronic
1176218816 20:63960453-63960475 AAGCACCTGCAGCAGGGGGCTGG + Intronic
1176218868 20:63960665-63960687 AGGCACCTGCAGCAGGGGGCTGG + Intronic
1176218914 20:63960875-63960897 AAGCACCTGCAGCAGGGGGCTGG + Intronic
1176218924 20:63960919-63960941 AAGCACCTGCAGCAGGGGGCTGG + Intronic
1178103235 21:29292383-29292405 TATCTCCTGCTGCAGGGGGTGGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179680511 21:43017768-43017790 GGGCACCTGCAGCAGTGGGTGGG - Intronic
1179943733 21:44656273-44656295 CCTGACCTGCAGGAAGGAGTAGG - Intronic
1180005158 21:45017427-45017449 CCACACCTGGAGCTGGGAGTGGG - Intergenic
1180006054 21:45021234-45021256 CCTCAGCTGGTGCAGGGAGTTGG - Intergenic
1180468978 22:15639132-15639154 CCTCACCCGAAACAAGGGGTGGG + Intergenic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1183273823 22:36878725-36878747 CATCACATGGAGCTGGGGGTGGG - Intergenic
1183386162 22:37515968-37515990 CGTGACCTGCAGCTGGCGGTAGG - Exonic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
949405701 3:3712175-3712197 CCTCAGCTCCTGCAGGGGATTGG - Intronic
950109104 3:10407169-10407191 CCTCACCTGCCAGATGGGGTGGG + Intronic
950215444 3:11155149-11155171 CGTCACCTGGAGTCGGGGGTGGG + Intronic
950425428 3:12922600-12922622 CCTCTCCTTCTGCACGGGGTTGG + Intronic
950584112 3:13880500-13880522 CCTCCCCTGAAGCTGGGGTTGGG - Intergenic
950611845 3:14132113-14132135 GGTCACCTGGAGCTGGGGGTGGG + Intronic
953860429 3:46539905-46539927 CCTCACCTGCAATGGGGGCTCGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955202131 3:56861005-56861027 CTTTCCCTGCAGCAGGGGGCTGG - Intronic
957245539 3:77711603-77711625 TCACCCCTACAGCAGGGGGTGGG + Intergenic
958431894 3:94049506-94049528 ACTCACCAGGAGGAGGGGGTGGG - Exonic
960459429 3:117914950-117914972 CTTCATCTGCAGCCGGGGATGGG + Intergenic
960701691 3:120445852-120445874 GCTCAGCTGCAGCAGGGGATAGG + Intronic
960937439 3:122912501-122912523 CCTCACCTGCCGCATGGAGTGGG - Intronic
960996401 3:123343373-123343395 CCTCACCTGTAACATGGGGTGGG - Intronic
962283149 3:134067030-134067052 CCTCATCTTCAGCAGGGCTTTGG - Intronic
962312577 3:134336970-134336992 CCTCACCTGAGGCAGGGCCTGGG + Intergenic
966177166 3:177151347-177151369 CCACAGCTGCAGCCGGGGGTTGG - Intronic
967480406 3:189966248-189966270 CCTGACCAGCACCAGGGAGTGGG - Intronic
967709502 3:192688359-192688381 CCTCACCTGTGGCAGAGGTTGGG - Intronic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
969556720 4:7916599-7916621 CCACTCCTGCAGGAGGGGGAGGG - Intronic
969583666 4:8079972-8079994 CCTCACCTGCACCATGCGGAAGG + Intronic
969597184 4:8156193-8156215 CCTGAGCTGGGGCAGGGGGTGGG - Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
972465034 4:39347315-39347337 CCTCTCATTCAGCAGAGGGTTGG - Intronic
972563287 4:40247575-40247597 ACTCACCTGCTGCATGGGCTTGG - Intergenic
975070833 4:70135407-70135429 AATCACCTGAACCAGGGGGTTGG + Intronic
985380411 4:189388958-189388980 CCTCACATGTGGCAGGTGGTGGG - Intergenic
985551877 5:537903-537925 CCTCCCCGGCAGCAGTGGGCTGG - Intergenic
986590438 5:9363407-9363429 CCTTACCTACTGCAGGAGGTGGG - Intronic
987197095 5:15537532-15537554 CATCCCCTGCAGGATGGGGTTGG + Intronic
989433335 5:41381334-41381356 ACTCACATGTAGCAGGGGTTAGG - Intronic
994059544 5:95459005-95459027 CCTCTCCTGAAGCAAAGGGTGGG + Intergenic
995146805 5:108796247-108796269 AGTCACCTGGAGCAGGGGATGGG + Intronic
995691503 5:114830685-114830707 CATCACCTCCAGCAAGGGTTTGG + Intergenic
996022520 5:118607162-118607184 CCACACGTGCAGCACGGGCTCGG - Intergenic
999282413 5:150374370-150374392 CCTCACCTGAAGCAGGGCCTTGG - Exonic
1000984141 5:167848838-167848860 GATCACCCGTAGCAGGGGGTTGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1002063948 5:176642992-176643014 CCCCTCCTGGAGCAGGGGATGGG + Intronic
1002279145 5:178120683-178120705 CCTCACCTGCGTGAAGGGGTTGG - Exonic
1003175283 6:3749551-3749573 CCTCACCTGGAGCAGGAGGGAGG - Intronic
1003646362 6:7915822-7915844 CCTGACCTCCAGCTGGGGTTAGG + Intronic
1004075334 6:12339660-12339682 CCTCACCTGGGGCAGAGGGCAGG + Intergenic
1005680557 6:28203355-28203377 CCTCCCCTGAGGTAGGGGGTGGG + Intergenic
1006131857 6:31874454-31874476 TCTCACCTGGAGCAGAGGGGAGG + Exonic
1006834078 6:36986222-36986244 CCTCACCGGCGTCAGGGGGCGGG + Exonic
1007082119 6:39115011-39115033 CCTGACTGGCAGCAGGGGGTTGG + Exonic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1007422698 6:41729105-41729127 CCTCCCCTGCAGCAGGGCTGTGG + Intronic
1007795374 6:44342800-44342822 CCTCCCCTGGGGAAGGGGGTGGG + Exonic
1010191413 6:73201028-73201050 CCTGAGCTGCAGCAAGGGGAGGG - Intergenic
1012500180 6:99879694-99879716 CCTCACCAGCAGCAGCCTGTTGG - Intergenic
1015483841 6:133745973-133745995 ACTCACCTGGAGCAGGGCTTGGG + Intergenic
1016662368 6:146596446-146596468 CCTGACATGGAGCAGGTGGTAGG - Intergenic
1018195744 6:161355083-161355105 CCTCAGCTGAAGCAGTAGGTAGG - Intronic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019527100 7:1485284-1485306 CCTCACCTGCTGCAGGGCCAGGG + Exonic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1019720816 7:2569489-2569511 CCTCACCCTCAGCAGGAGGAGGG + Intronic
1019736424 7:2652226-2652248 TCTCACCTGCTGGAAGGGGTTGG - Exonic
1019768334 7:2867370-2867392 CCTCCCCTGCAGCCTGGGGGTGG + Intergenic
1020035850 7:4962753-4962775 CCTCATCGGCAGGAGGGGATAGG - Intergenic
1022286018 7:28956732-28956754 CCTCCCCTGCGGCCGTGGGTAGG + Exonic
1023364147 7:39446215-39446237 CCTCCATTGCAGCACGGGGTGGG + Intronic
1024142965 7:46480694-46480716 CCTCAGCTGCAGGTTGGGGTTGG + Intergenic
1024186084 7:46949414-46949436 CCTCACCTCCAGCAGAGGGAGGG + Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1025236925 7:57240754-57240776 CCACACCTGCGGCAGGTGGGCGG + Intergenic
1029458698 7:100683624-100683646 CCTCACCACCTGCAGGGGGCAGG + Exonic
1030446947 7:109657758-109657780 CGTCACCAGGAGTAGGGGGTAGG + Intergenic
1032684902 7:134223417-134223439 TCTCAGAGGCAGCAGGGGGTAGG + Intronic
1032939078 7:136767968-136767990 CCTCTCCTGAAGCAGAAGGTAGG - Intergenic
1033137595 7:138798028-138798050 ACTCACCTGCAGCAGGCACTCGG + Exonic
1034594102 7:152172159-152172181 CCAGACCTGTAGCAGTGGGTAGG - Intronic
1035073155 7:156159409-156159431 CCACTCCTGCAGCATGGGGATGG + Intergenic
1035337698 7:158140664-158140686 CATCACCTGCAGGTGGGGCTGGG + Intronic
1035594191 8:841733-841755 ACTCACCTGCTGCCGGGTGTGGG - Intergenic
1035677882 8:1467809-1467831 CCACCCCTGCAGCAGGGCGCAGG - Intergenic
1039269502 8:35865676-35865698 CCTCACCAGAAGCAGAGGATGGG - Intergenic
1039517250 8:38144381-38144403 CCACCCCTGCAGTAGGAGGTAGG + Exonic
1040982247 8:53255803-53255825 CCTAACCTGGGGCAGAGGGTAGG + Intergenic
1041259333 8:56006583-56006605 CCTCACCAGAAGGAGGTGGTGGG - Intronic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1045300623 8:100907524-100907546 CCTCACATGCAGCAGGTGCCTGG - Intergenic
1045321135 8:101081985-101082007 CCTCTCCTGCAGAAGTGGGTAGG - Intergenic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1049031521 8:140041575-140041597 CATCCCCTGCAGAAGGGGTTGGG - Intronic
1049201778 8:141343856-141343878 CCTCACCTGGAAAAGGGGCTTGG + Intergenic
1049234513 8:141505755-141505777 CCATAACTGCAGCAGAGGGTTGG + Intergenic
1049306502 8:141906956-141906978 CCCCACATGCAGCAGGAGGAAGG - Intergenic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1049501968 8:142971733-142971755 CCTGACCTCCTGCAGGTGGTGGG - Intergenic
1050388278 9:5112196-5112218 CCCCACCAGCAGCATGGGGCCGG - Intronic
1051355731 9:16238326-16238348 GCTCCCTTGCAGCTGGGGGTTGG + Intronic
1053162069 9:35820063-35820085 CCTCACCTCCATCAAGGGATAGG - Intronic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1055739981 9:79377487-79377509 CCTGCCCTGCAGCTGGGGGAGGG - Intergenic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1057203504 9:93156611-93156633 CCGTACCTGCAGCAGGGAGAAGG - Intergenic
1057818630 9:98314596-98314618 CCTCACCGGGAGCAGGAGGGAGG - Intronic
1058886527 9:109325790-109325812 CCACACCTGCAGCACAGTGTGGG - Intergenic
1059529487 9:115022950-115022972 CCTGACATGCAGCAGGTGTTGGG - Intronic
1060045048 9:120333214-120333236 CCTAACCTGCAGCAGCAGGGGGG + Intergenic
1060509355 9:124220872-124220894 CCTCCACTGCAGCATGGGGAGGG + Intergenic
1060516744 9:124270692-124270714 CGTTACCTGCAGCAGGGGCCCGG - Intronic
1060528412 9:124333416-124333438 CCTCCCCTGGGTCAGGGGGTTGG + Intronic
1060877506 9:127093826-127093848 CCACACCTGCATGAGGCGGTTGG + Exonic
1061380722 9:130255269-130255291 CCTCAGCTGCAGGAGAGGATGGG + Intergenic
1062022981 9:134327758-134327780 CCTCACATCCAGGAGGGGCTAGG - Intronic
1062284016 9:135765179-135765201 CCTCACCTGGAGCCGGGGGTGGG - Exonic
1062360765 9:136186875-136186897 TCTCACCTGCAGTGTGGGGTCGG - Intergenic
1062426828 9:136510005-136510027 CCACACCTGCGGGAGGGGGCCGG + Intronic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1188577096 X:31664611-31664633 CCTCAACTGGAGCAGGAGGCAGG + Intronic
1188870718 X:35367594-35367616 CCTCACCTGCTGCATGGGGAAGG + Intergenic
1189227015 X:39421560-39421582 CAGCACCTGCAGCAGAGAGTGGG + Intergenic
1189324126 X:40102770-40102792 CCTCGCCTGCAGCAGGAAGGTGG + Intronic
1189528488 X:41853023-41853045 CCTAACCTTCATCTGGGGGTGGG - Intronic
1189954102 X:46260800-46260822 CCTGCCCAGCAGCAGGGGATAGG + Intergenic
1190503058 X:51098119-51098141 TGTCACCTGCTGCATGGGGTTGG - Intergenic
1190581928 X:51898202-51898224 CTGGACCTGCAGCTGGGGGTTGG + Intronic
1191700758 X:64039136-64039158 ACTCACCTGGAGCTGTGGGTGGG - Intergenic
1191797386 X:65035182-65035204 CCCCGCCCGCCGCAGGGGGTGGG - Intergenic
1192203281 X:69080795-69080817 CCCCATCTGTAGCTGGGGGTGGG + Intergenic
1192466129 X:71357409-71357431 CCTTACCCACTGCAGGGGGTGGG - Intergenic
1192948463 X:75990590-75990612 ACTCACCTGCAGCAGTGTGCAGG + Intergenic
1193245920 X:79229563-79229585 CCCCACCTTCAGCATTGGGTAGG - Intergenic
1195206045 X:102601124-102601146 AATCAGCAGCAGCAGGGGGTGGG - Exonic
1197720880 X:129743838-129743860 CCTCTCCTGAAGCAGCGGTTGGG - Intronic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1200115247 X:153767174-153767196 GCTCACCAGCAGCAGCTGGTTGG - Exonic