ID: 1025021547

View in Genome Browser
Species Human (GRCh38)
Location 7:55484343-55484365
Sequence AAGACTGGCAAGGGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 2, 2: 2, 3: 37, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025021547_1025021554 4 Left 1025021547 7:55484343-55484365 CCTTCCACCCCCTTGCCAGTCTT 0: 1
1: 2
2: 2
3: 37
4: 364
Right 1025021554 7:55484370-55484392 CACTGAACCTAGAGAAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025021547 Original CRISPR AAGACTGGCAAGGGGGTGGA AGG (reversed) Intronic
900476827 1:2879981-2880003 AACACTGGCATGGGGCTGCACGG + Intergenic
900769904 1:4532489-4532511 AAGACTGGGAAGCTGATGGAAGG - Intergenic
900923410 1:5688220-5688242 AAGGCCGGCAAGGGGAGGGAAGG - Intergenic
901865387 1:12103440-12103462 GAGATTGGGAAGGGGGTTGAGGG - Intronic
902405885 1:16183435-16183457 AAGACTGGCAAAGGGGGGCTGGG - Intergenic
902412837 1:16221493-16221515 TAGACAGGCAGGTGGGTGGAGGG + Intergenic
902659178 1:17889570-17889592 AGTAGTGGCCAGGGGGTGGATGG + Intergenic
902791942 1:18775370-18775392 AAGCCTGGCAAGGGAGCAGAGGG + Intergenic
903175151 1:21576118-21576140 TAGACAGGCAGGTGGGTGGATGG + Intronic
903953535 1:27010314-27010336 AAGCCTTGCAGGGGGGTAGAGGG + Intronic
904009461 1:27381507-27381529 AGAACTGGCAATGGGGAGGAGGG + Intronic
904199691 1:28811951-28811973 CAAAGTGGCAAGGGGGTGGGAGG + Intergenic
904213125 1:28898726-28898748 AAGGCGGGCAAGGGGCAGGAGGG - Intronic
904420631 1:30388904-30388926 AAGAGTGGGAAGGGGGTAGGAGG - Intergenic
904469526 1:30727860-30727882 AAGACTGACAATGGCCTGGAAGG - Intergenic
905461941 1:38127831-38127853 CAGAATGGCAAGGAGGAGGAGGG - Intergenic
905908724 1:41639254-41639276 GATACTGGCAAAGGGGTGGATGG + Intronic
906552663 1:46678594-46678616 AAGACTGGCCAGGACGTGGATGG - Exonic
906652298 1:47521411-47521433 AGCTCTGGCAAGGGGGTAGATGG - Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
908292506 1:62682507-62682529 AAAACAGGGAAGGGGGTGGAGGG + Intronic
908407281 1:63827510-63827532 AATGCTGACAAGGGGTTGGATGG + Intronic
910648684 1:89540728-89540750 AACACTGGCAACTGTGTGGAGGG + Intronic
911165912 1:94724138-94724160 AAGCCTGGTTAGGGAGTGGAAGG - Intergenic
911484126 1:98484301-98484323 AAAAATGGCAAAGGGATGGATGG - Intergenic
912631003 1:111246777-111246799 AAGACTGGGGAAGGAGTGGAAGG + Intergenic
912670656 1:111620623-111620645 AAGGCGGGAAAGGGGCTGGAAGG - Intronic
915113016 1:153576661-153576683 AAGACAGGAAAGAGGGTGGGAGG + Intergenic
915836623 1:159181819-159181841 GAGACTGGGAAGTGGGTGGCAGG - Intronic
917238107 1:172916708-172916730 AAGACAGGCAAGGAGTTGGGTGG - Intergenic
917382879 1:174434045-174434067 AAGACTGGCAAGAGGTATGAGGG - Intronic
917462133 1:175241099-175241121 AAGAGTGGAAAGGGGGCCGAGGG + Intergenic
919150404 1:193690030-193690052 CAGGGTGGGAAGGGGGTGGATGG + Intergenic
919712381 1:200740045-200740067 AAGACAGGCACGGGGAGGGAGGG - Intronic
919761690 1:201102159-201102181 AAGACAAGAAAGGGGGAGGAGGG + Intronic
919880330 1:201896762-201896784 GTGACAGGCAAGTGGGTGGAGGG + Exonic
921513046 1:216055385-216055407 AAAACTGGCTAGGGGAAGGAGGG + Intronic
922196567 1:223364452-223364474 GAGACTGGCGAGGGCGGGGACGG + Intergenic
923222919 1:231912881-231912903 AAGACAGAAACGGGGGTGGAAGG - Intronic
923465226 1:234242284-234242306 CAGGCTGGGAAGCGGGTGGAAGG - Intronic
923519106 1:234722336-234722358 AGGGCTGGCGTGGGGGTGGAAGG + Intergenic
924246931 1:242094289-242094311 AGGACTGACAAGGGGGTAGCGGG - Intronic
924597998 1:245464051-245464073 AAGACTAGAAAGGGTGGGGATGG - Intronic
924845620 1:247767177-247767199 AAGGGTGGGAAGGGGGTTGAGGG - Intergenic
1064532383 10:16323396-16323418 AAGACTAGCAAGGTGGAGAAAGG + Intergenic
1066329708 10:34407194-34407216 ATGCCTGCCAAGGGGGTGGAGGG + Intronic
1067140235 10:43650170-43650192 AAGTCTGAGAAAGGGGTGGAGGG + Intergenic
1068798349 10:61109850-61109872 AAGAATGGCAAGGCTGTGGCTGG + Intergenic
1068933836 10:62617391-62617413 AAGCCTGCCACTGGGGTGGAAGG + Intronic
1071502623 10:86214406-86214428 AAGACTGGGGACGGTGTGGAAGG - Intronic
1071824164 10:89307889-89307911 TAGACTGGGAAGGAGGAGGAAGG - Exonic
1071972269 10:90920314-90920336 AAGAATGGCAATGGGGAGGCAGG - Exonic
1072786624 10:98287552-98287574 GAGACTGGCATGGGAGTGGGTGG - Intergenic
1073450275 10:103605105-103605127 AAGACATGCTGGGGGGTGGAGGG + Intronic
1074434053 10:113418660-113418682 AAGACTGGGAAGGGTGCTGATGG + Intergenic
1074935469 10:118175130-118175152 AACACTGGAAAGGGGGTTGAAGG - Intergenic
1074949137 10:118311944-118311966 AGGACTGGCAGGTGGGTGTAAGG - Intronic
1075239484 10:120765017-120765039 AAGACAGGCCAGGGGGAGGAGGG - Intergenic
1076076498 10:127537763-127537785 AAGGGTGGCAATGGGGTTGAGGG - Intergenic
1077318301 11:1928918-1928940 ATGCCTGGGGAGGGGGTGGAAGG - Intronic
1077462057 11:2715607-2715629 AAGGCTGGCAGGGGCTTGGAAGG - Intronic
1077474731 11:2780948-2780970 AGGACAGGCACAGGGGTGGAAGG - Intronic
1078171583 11:8932759-8932781 AGGGCTGGAAAGGGGATGGACGG - Intronic
1079274977 11:19027003-19027025 AAGTGTGGCAAGGAGGTGGAGGG + Intergenic
1079505758 11:21150324-21150346 CAGACTGGCAGGGGGGCAGAGGG + Intronic
1080343018 11:31290684-31290706 AAGAATGGCATGGGGCAGGATGG - Exonic
1080778097 11:35404759-35404781 AAGACTGTCAATGGGGTTCAAGG - Intronic
1081426470 11:42931443-42931465 TGGACTGGGAAAGGGGTGGAGGG + Intergenic
1081537275 11:44005059-44005081 CAGACTGGCACGGGGGAGAAGGG - Intergenic
1082757991 11:57096866-57096888 TATAATGGCAAGGGGGTGGGGGG + Intergenic
1082989780 11:59197404-59197426 AAGACTCGCAAGGAAGTAGAGGG + Intronic
1083936750 11:65873368-65873390 AAGACGGTCCTGGGGGTGGAGGG - Intronic
1083958710 11:66002181-66002203 AAGACGGACAAGGGAGGGGACGG - Exonic
1084148059 11:67275468-67275490 AAGAAGGGGAAGGGGGTGGGTGG - Intronic
1084425480 11:69081718-69081740 AAGGCGGGCAAGGGTGTGGCGGG + Intronic
1084476070 11:69390523-69390545 AAGACTGGCATGAAGGTGAAGGG + Intergenic
1085095211 11:73755072-73755094 TAGCCTGGCATGGTGGTGGACGG - Intronic
1085761055 11:79241856-79241878 AAAACTAGCAAGGGGGCGGCAGG + Intronic
1086321526 11:85652607-85652629 AAAACTGGCAAGGGGCTGCTAGG + Intronic
1088645183 11:111912107-111912129 AGGACTGGAAAGGAGGAGGAGGG - Intronic
1089571814 11:119416257-119416279 AGGACTGGCGAGGGAGTGGATGG + Intergenic
1089983262 11:122789865-122789887 AAGACTGGCAGAGGGGAGGGGGG - Intronic
1090038101 11:123265953-123265975 AACACTGGAAATGGGGAGGATGG + Intergenic
1090693343 11:129209324-129209346 AAGAGAGGAAAGGGGCTGGATGG + Intronic
1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG + Intronic
1091214327 11:133891315-133891337 AAGCCAGGCAATGGGGTGGGGGG + Intergenic
1094842337 12:34347351-34347373 AAAACTGGCAAGGCAGAGGAGGG - Intergenic
1095223056 12:39641502-39641524 AAGACAGGCAAGGGGAAGGAAGG + Intronic
1096755252 12:53794058-53794080 AGGACTGGCCAGGTGGTGGATGG - Intergenic
1097021065 12:56021143-56021165 AAGACAGTGAAGGGGGTGGGTGG - Intronic
1097414311 12:59295636-59295658 AAAGCTTCCAAGGGGGTGGAAGG - Intergenic
1097989120 12:65816258-65816280 AAAGCTGGCAAGGATGTGGATGG + Intergenic
1098285680 12:68904758-68904780 CAGCCTGGCATGTGGGTGGAAGG + Intronic
1098429567 12:70405005-70405027 AAGAGTGGCCAGAGGGTGAAAGG + Intronic
1099178077 12:79445452-79445474 AAGACTGGGAAGGGGAAGGTAGG - Intronic
1101500444 12:105299181-105299203 TAGACTGGGGAGGGTGTGGAAGG + Intronic
1102112810 12:110377754-110377776 TAGACTGGCAAGAGTGTTGATGG + Intronic
1102500906 12:113351869-113351891 GTGATTGGCCAGGGGGTGGAGGG - Intronic
1102913651 12:116737488-116737510 AAGAAAGGGAAGGGGGAGGAAGG + Intronic
1103091744 12:118103113-118103135 AAGACTTGCAAAGGTGTGTAGGG + Intronic
1104365165 12:128170313-128170335 AAGAATTGCAAAGGGGTGGGCGG + Intergenic
1104388296 12:128370165-128370187 AAGACTGGCAGGGGGCTTGCTGG - Intronic
1106498587 13:30306443-30306465 CAGGCTGGCAAGGGGGGGGTGGG + Intronic
1106548549 13:30751679-30751701 CACACTGGCATGGGGGTGGTCGG - Intronic
1106655640 13:31743581-31743603 AACAGTGGGAAGGGGGAGGATGG - Intronic
1107685644 13:42895540-42895562 AAGACTGGCAGTGGAGTGCAGGG - Intronic
1108088032 13:46816585-46816607 AAGAGTGGCATGGGTGAGGAGGG - Intergenic
1108161323 13:47643001-47643023 AAGACTGCCAAGGGGAAGTAGGG - Intergenic
1109248881 13:59993803-59993825 ATGACTGGCAAGGGGGTGGAAGG - Intronic
1110421664 13:75316758-75316780 TACACTGGGATGGGGGTGGAGGG + Intronic
1110620251 13:77586539-77586561 AATGATGGCAAGGGAGTGGAAGG - Intronic
1111916132 13:94362533-94362555 AAGACTGGTAAGGGGGTGAAAGG + Intronic
1115144921 14:30215404-30215426 AAGAGTAGCAAGGAGGCGGATGG - Intergenic
1117340742 14:54789205-54789227 GAGACTGGGAGGGGGGTGGAGGG + Exonic
1118356148 14:65015516-65015538 CAGCCTGGCAAGGGGGAGGAGGG - Intronic
1118722118 14:68601831-68601853 AAGACTTTCAAGGGTGAGGAGGG - Intronic
1119192596 14:72693303-72693325 AAGCCTGGCTCTGGGGTGGATGG - Intronic
1120378122 14:83735272-83735294 GAGACTGGGAAGTGAGTGGAAGG - Intergenic
1120757428 14:88257335-88257357 GAGACTGGGAAGGGGGTCGTGGG - Intronic
1121725058 14:96141272-96141294 GAGACAGACAAGAGGGTGGAGGG + Intergenic
1122277776 14:100604021-100604043 AGGACGGGCAAGGGGGTGAGGGG - Intergenic
1124581087 15:30955636-30955658 AACACTGCCAAGGGGGGGGCGGG + Intronic
1124866710 15:33499305-33499327 AAGAGTGGCAGGAGGGAGGAGGG - Intronic
1124918481 15:33999789-33999811 AAGACTGGCAAGAGGGGAGCGGG - Intronic
1125409915 15:39395427-39395449 AAGCCAGGGAAGAGGGTGGAGGG + Intergenic
1126881263 15:53100777-53100799 AAGACTGGCGAGGGGAGGCATGG + Intergenic
1127115368 15:55721191-55721213 AGCACTGGCAAGGGGATGAATGG - Intronic
1128675494 15:69605445-69605467 AAGACAGACAAGAGGGTGGTGGG + Intergenic
1128723314 15:69969172-69969194 AAGACTGGAGTGGGGATGGATGG + Intergenic
1129090593 15:73146028-73146050 AAGCCAGGCAAGGGAGTGGAAGG - Intronic
1129102967 15:73283560-73283582 GACACTGGCAAGAGGCTGGAGGG - Intronic
1129520628 15:76183863-76183885 AAGACAGCGAAGGGGATGGAGGG - Intronic
1129842301 15:78751317-78751339 AAGAGTGCCAAGGCGGTGGCAGG + Intergenic
1130644625 15:85713407-85713429 AAGAATTGCAAGGATGTGGATGG - Intronic
1130871193 15:87973635-87973657 AAGATTGGCAATGTGGTGGGTGG + Intronic
1130899712 15:88198236-88198258 AAGGATGGGAAGGGGGTGGCTGG - Intronic
1131562294 15:93455131-93455153 ATGAGTGGGAAGGGGGTGGCTGG + Intergenic
1131997137 15:98143780-98143802 AACATTAGCAAAGGGGTGGAGGG - Intergenic
1132129442 15:99262043-99262065 AACACAAGCAAGGAGGTGGAAGG - Intronic
1132733672 16:1375318-1375340 AAGCCTGGCTCGGGAGTGGACGG + Intronic
1133648988 16:7791649-7791671 AAGAGTGGCAAGGGGGGGTGAGG + Intergenic
1133933284 16:10249577-10249599 AAGACTCCCAACGGGGAGGAGGG + Intergenic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1137764933 16:50970792-50970814 AGGACTGGGAAGGGGAAGGAGGG + Intergenic
1137871001 16:51950247-51950269 AAGACAGACAAGGAGGAGGAAGG + Intergenic
1138989318 16:62371691-62371713 AAGAAAGGGAAGGGGGTGAAGGG - Intergenic
1140038612 16:71390260-71390282 ACCATTGGCAAGGTGGTGGATGG - Exonic
1140213824 16:72991798-72991820 AACACTGGCCAGGGGCTAGATGG + Intronic
1140376175 16:74447010-74447032 AAGACTGACAAGGGGGTGATGGG + Intergenic
1141855928 16:86681550-86681572 AAGACCGGCGAGGGGCTGGCAGG + Intergenic
1142562939 17:821832-821854 GAGACAGGGAAGGGGGAGGAAGG - Intronic
1143763058 17:9118645-9118667 AGCACTGGAAAGGGGGTGGGTGG - Intronic
1144677001 17:17168227-17168249 AAGGCTGGCAAGGGGATTGGGGG - Intronic
1144877709 17:18411080-18411102 AAGACTGGAAAAGGGGTGAAGGG - Intergenic
1144911494 17:18686003-18686025 GAGGCTGGGAAGGGTGTGGAGGG - Intergenic
1145016569 17:19402661-19402683 GAGACTGGCAAGGGTGTTCAAGG + Intergenic
1145154520 17:20533323-20533345 AAGACTGGAAAAGGGGTGAAGGG + Intergenic
1147204164 17:38824879-38824901 AAGACCGGGGAGGGGGCGGATGG - Intronic
1147918793 17:43904052-43904074 GAGAATGGCTTGGGGGTGGAGGG - Intronic
1148740511 17:49890023-49890045 GGGACCGGCAAGGGGTTGGAGGG + Intergenic
1148790085 17:50168042-50168064 AAGACTGGCATTGGTGGGGAAGG - Intronic
1149599213 17:57882314-57882336 GAGACTGCCAAGGGAGGGGAGGG + Intronic
1149895054 17:60422603-60422625 CAGATGGGCAAGGGGGTGAAGGG + Exonic
1150485271 17:65538796-65538818 AAGATTGGAAAGGAGGTGGGAGG + Intronic
1150838964 17:68590747-68590769 CAGACTGACAGGGTGGTGGAGGG - Intronic
1150905512 17:69332730-69332752 AATATTGGCAAGGGGATGAAAGG - Intergenic
1151619439 17:75236947-75236969 AAGCCTGGCAAGGGGCAGGGAGG + Exonic
1151857252 17:76730549-76730571 AAGACTGCCACGGCCGTGGAAGG - Intronic
1152296252 17:79468809-79468831 AAGACAGGCAGGAGGATGGATGG + Intronic
1152506792 17:80754775-80754797 AAGACTGGCAAGATGGTCTAGGG - Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1155089112 18:22488977-22488999 AAGACTGGGAAGTGGGAGGAGGG + Intergenic
1157217985 18:45801651-45801673 AAGACTGGGAAAGGAATGGAAGG - Intergenic
1157502587 18:48201949-48201971 AAGACAGGCTGGTGGGTGGAAGG - Intronic
1157618517 18:49001976-49001998 GTGACAGACAAGGGGGTGGAGGG + Intergenic
1158857286 18:61555262-61555284 CAGCCTTGCATGGGGGTGGATGG + Exonic
1159700757 18:71623822-71623844 AACACTTCCAAGGGGGTGGAGGG - Intergenic
1160181284 18:76638715-76638737 GAGACTGGAAAGGGTGTGGAAGG + Intergenic
1160872116 19:1282331-1282353 GAGAGTGGGAAGGGGGAGGAGGG + Intergenic
1160902063 19:1433631-1433653 GAGACTGGCAGGGGGGTGTGAGG + Intronic
1161146761 19:2683568-2683590 AAGACTGGCAGTGGGGAGGCGGG + Intronic
1161528015 19:4769424-4769446 CAGAATGGCAATGGGGTGGCGGG - Intergenic
1161785667 19:6324005-6324027 CAGAGTCGGAAGGGGGTGGAGGG - Intronic
1161853558 19:6751336-6751358 AGGACTGGGTTGGGGGTGGAGGG - Exonic
1164022791 19:21323476-21323498 AAGATTAGAAAGGAGGTGGAAGG - Intronic
1164774998 19:30845967-30845989 CTGACTGGGTAGGGGGTGGATGG + Intergenic
1164840572 19:31389622-31389644 GAGAATGGCAATGGGGTGGGGGG - Intergenic
1164901580 19:31930595-31930617 GAGATTGGCAAGGAGGTGGAAGG - Intergenic
1165341315 19:35214252-35214274 AAGGAGGGCATGGGGGTGGAAGG - Intergenic
1165984423 19:39755475-39755497 AAGATTGGCAAAGCTGTGGATGG - Intergenic
1166691103 19:44821498-44821520 AGGTCTTGCAAGGGGGCGGATGG - Intergenic
1167427816 19:49438460-49438482 GAGACTGGGACGGGGGAGGAAGG + Intronic
1167699630 19:51034877-51034899 AAGACAGGCAGGTAGGTGGACGG - Exonic
1168260004 19:55187999-55188021 AGGTCTGGCCAGGGGGTGGGGGG + Intronic
925344830 2:3163810-3163832 AAGAGTGGCAGGGAGGTGGGAGG + Intergenic
925642353 2:5998280-5998302 AAGACTGGAGAGGGGGCGTAGGG + Intergenic
925978512 2:9157534-9157556 TAGACTGGCATGGGAGGGGAGGG + Intergenic
926107818 2:10163322-10163344 AAGACGGGCGGGGGGGTGGGGGG + Intronic
926746913 2:16166462-16166484 AACACTGCCAAAGGGCTGGAGGG + Intergenic
927696725 2:25244428-25244450 GAGCATGGCTAGGGGGTGGAGGG + Intronic
928912663 2:36438658-36438680 AAGACTGGTAAGAGGGAGCAGGG + Intronic
929438818 2:41949368-41949390 AAGACTGGAATGGGGTGGGAGGG + Intronic
929515493 2:42602854-42602876 CAGAAGGGAAAGGGGGTGGATGG - Intronic
931956971 2:67438444-67438466 AGGACTGGGATGAGGGTGGAAGG - Intergenic
932173709 2:69580024-69580046 AAGACAGGAAATGGGGTAGATGG - Intronic
932487633 2:72094140-72094162 AGGACTGAGAAGGAGGTGGAGGG - Intergenic
932692103 2:73921727-73921749 AAGACTGGAGTAGGGGTGGAAGG - Intergenic
932861061 2:75291669-75291691 AAGTCTGGCACGGGGAGGGAGGG - Intergenic
934080557 2:88464115-88464137 AAGCCTGGGCAGGGGGTGGCCGG - Intergenic
934604348 2:95682760-95682782 AAGACTGGCGAGGGGAGGGCGGG - Intergenic
937213845 2:120297769-120297791 AAAAATGGCGAGGGGGTGAAGGG - Intergenic
938016986 2:127875379-127875401 AAGAAGGGCAAGTGGGGGGAGGG + Intronic
939774520 2:146368063-146368085 AAGAATGGGAAGGGGGTGTGTGG - Intergenic
939811718 2:146840827-146840849 AAGACTATCATGGGGTTGGACGG + Intergenic
940646933 2:156401522-156401544 AAAAATGGCAGGGGGTTGGAGGG - Intergenic
941622983 2:167799341-167799363 GAGACTTGCAAGGGGGAGGGTGG - Intergenic
942042964 2:172083138-172083160 GAGACTTGCAAGGTGGGGGAAGG - Intergenic
942934738 2:181541440-181541462 AACACTGGGAATGTGGTGGAGGG + Intronic
943487644 2:188507047-188507069 AAGAATGCAAAGTGGGTGGATGG - Intronic
943763521 2:191635531-191635553 AAGGCTGGCCTGGGGATGGAGGG + Intergenic
945266073 2:207892678-207892700 ACCAATGGCAATGGGGTGGATGG - Intronic
948199410 2:236119212-236119234 AAAGCTGGGGAGGGGGTGGATGG - Intronic
948395301 2:237640864-237640886 AAGAGAGGCCAGGGGTTGGAAGG - Intronic
1169476327 20:5934222-5934244 AAGCCTGGCAAGGAGAGGGATGG + Intergenic
1170444823 20:16415655-16415677 AAGACTGGAAAGGGGATGGAGGG - Intronic
1172357103 20:34287889-34287911 AAGACTGTCAAGGATGTTGAGGG + Intronic
1172499053 20:35412039-35412061 AAGACTGGCAAGGGGGGCGCAGG + Exonic
1172906519 20:38374124-38374146 AAGTCTGGCCAGGGGCAGGACGG + Intronic
1173620625 20:44433220-44433242 AAGAATGGCAAGAGGGTCCAAGG + Intergenic
1174195314 20:48768813-48768835 AAGACTGGCAAGGGGCTCAAGGG + Intronic
1174203950 20:48826341-48826363 AAAAGTGGCCAGCGGGTGGAGGG - Intronic
1174498865 20:50969528-50969550 AAGATTGGCCTGGGGGTGGGGGG - Intergenic
1175315474 20:58043883-58043905 AAGGCTGGCATGGGGGTAGGGGG + Intergenic
1176676650 21:9784767-9784789 AAGAGTGGTGAGGAGGTGGAGGG + Intergenic
1178135241 21:29619484-29619506 AAGAGTGGGAAGGGGGTGAGCGG + Intronic
1178760908 21:35401832-35401854 AATACTAGCAGTGGGGTGGAAGG + Intronic
1179000813 21:37456457-37456479 TAAACTGGCAAAGGGGTGGCTGG - Intronic
1182086403 22:27564061-27564083 AACTCTGGCCAGGGGGTGGCAGG - Intergenic
1182551302 22:31102240-31102262 AAGACTGTCCTGGGGGTGGGAGG + Intronic
1182995599 22:34809163-34809185 AAGAATGACAAGGAGGTTGAAGG + Intergenic
1183096914 22:35557752-35557774 GAGGCTGAGAAGGGGGTGGAGGG + Intergenic
1183168640 22:36167130-36167152 AAGAGTGGGAAGGAGGAGGAGGG + Intergenic
1183879518 22:40815315-40815337 AAAACTGGCCATGGGCTGGAGGG + Intronic
1184324539 22:43773447-43773469 AAAATTGGCAAGGGGATGAAAGG - Intronic
1184326842 22:43794754-43794776 GAGACTGGAATGGGGGAGGAGGG - Intronic
1184508479 22:44918199-44918221 AGGACTGGCGTGGGGGCGGATGG + Intronic
1184782077 22:46654542-46654564 AAGGTTGGCAAGGGGCTGGGTGG + Intronic
1184860553 22:47171216-47171238 AAGACTGGCATGGAGGGGAATGG - Intronic
1185127277 22:49018133-49018155 AAGGCTATCCAGGGGGTGGAGGG - Intergenic
949639350 3:6017451-6017473 AAAAATAGCAAAGGGGTGGAGGG + Intergenic
950113025 3:10432670-10432692 GAGGCTGGCAAGGAGGTGGCAGG + Intronic
950863862 3:16173736-16173758 AAGAGAGGCAAGGGGGCGGGGGG - Intergenic
951162424 3:19441022-19441044 AAGACTGGCAGGCAGGAGGAGGG + Intronic
952208194 3:31201555-31201577 AAGATTGGGAAAGGTGTGGAAGG - Intergenic
952273758 3:31857767-31857789 AAGATTGGCAGGGGGGTGGGGGG + Intronic
953123644 3:40070700-40070722 CAGGGTGGTAAGGGGGTGGATGG - Intronic
954387366 3:50251204-50251226 CAGAAGGGCAAGAGGGTGGAGGG - Intronic
954612572 3:51953832-51953854 AAGACTGGCAGATGGGAGGAGGG - Intergenic
954874800 3:53795017-53795039 GAGACTGGGAAGGGGCTGGAGGG - Intronic
956907057 3:73777360-73777382 AAGAATGGCAAGGTGGTTGGGGG + Intergenic
957267955 3:77991676-77991698 TAGACTGAAAAGGGGATGGAAGG - Intergenic
958507309 3:94996490-94996512 GAGACTGGCAGGAGTGTGGAGGG - Intergenic
959913509 3:111791969-111791991 AAGGCTGGTTAGGGGATGGAAGG - Intronic
960102504 3:113759800-113759822 AGTACTGGCAAGGGTGTGGGGGG - Intronic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
961842882 3:129732380-129732402 CAGACTGGCAACAGGGTGGGTGG - Intronic
963809882 3:149765317-149765339 ATGACTGGCAAGGGGCATGAAGG + Intronic
965707823 3:171526775-171526797 TAGATTGTCAAGGGGGTGGCTGG - Intergenic
966340539 3:178920849-178920871 GAGAGTGGCAAGGGGGGTGAGGG + Intergenic
966340902 3:178924102-178924124 AACACTGACCAGGGGGGGGATGG - Intergenic
966728090 3:183126345-183126367 AGGACTGGGAAGGAAGTGGAGGG + Intronic
966919523 3:184602671-184602693 CAGGCAGGCAAGGGGGTGGTGGG - Intronic
967830347 3:193913198-193913220 CATAATGGGAAGGGGGTGGAGGG + Intergenic
968530072 4:1086847-1086869 GAGGATGGCATGGGGGTGGAAGG + Intronic
970008645 4:11434462-11434484 TGGCCTGTCAAGGGGGTGGAGGG - Intergenic
970215204 4:13751808-13751830 AAGGATGGTAAGCGGGTGGATGG - Intergenic
970423897 4:15929215-15929237 AAGACTGTCCAGGGAGTGTAAGG - Intergenic
971394498 4:26215815-26215837 GAGACTGGCAAGGAGGTGAGAGG - Intronic
973544006 4:51962056-51962078 CAGACTGGCAAGGTGGTGGTGGG + Intergenic
976931256 4:90569828-90569850 TCAACAGGCAAGGGGGTGGATGG - Intronic
977867623 4:102048763-102048785 AAGACTGGCAAGGGATTGCCAGG + Intronic
977894678 4:102349770-102349792 GAGATGGGCAAGGGGGAGGAAGG + Intronic
977923234 4:102669352-102669374 AGGAGTGACAAGGGGCTGGAGGG - Intronic
979600252 4:122579618-122579640 AAGTCTGCCAAAGGGGAGGAGGG - Intergenic
979795363 4:124839659-124839681 AGGGATGGGAAGGGGGTGGAGGG - Intergenic
980422378 4:132580378-132580400 AATGCTGGACAGGGGGTGGAAGG - Intergenic
981251398 4:142606241-142606263 GAGACTGGGAAGGGTGGGGAAGG + Intronic
982913880 4:161180560-161180582 AAAACTGGCAAGAGGCTGGGAGG - Intergenic
983742184 4:171149656-171149678 CATACTGGCAAGGAGGAGGAAGG - Intergenic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
985398887 4:189574001-189574023 AAGAGTGGTGAGGAGGTGGAGGG - Intergenic
986384237 5:7216204-7216226 AAGAGTGGGCATGGGGTGGAGGG + Intergenic
987264256 5:16235775-16235797 AGTAGTGGCAATGGGGTGGAGGG - Intergenic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
987920576 5:24274868-24274890 GAGACTGGGAAGGGGGTAGGGGG + Intergenic
988574074 5:32402241-32402263 AAAACTGAGAAAGGGGTGGATGG + Intronic
988714457 5:33811364-33811386 AAGCATGGCAAGGGAGTGCAGGG + Intronic
991761872 5:69924951-69924973 AAGACTGGGTAGGGCGGGGAGGG - Intergenic
991785457 5:70193149-70193171 AAGACTGGGTAGGGCGGGGAGGG + Intergenic
991841100 5:70800000-70800022 AAGACTGGGTAGGGCGGGGAGGG - Intergenic
991854422 5:70952667-70952689 AAGACTGGGGTGGGGGTGGGAGG + Exonic
992472683 5:77074159-77074181 AAGACTGGCATGGGGGCAGAGGG + Exonic
993138182 5:83997016-83997038 AATACTGGCTAGGGGATAGAGGG + Intronic
993425832 5:87763153-87763175 AGCAGTGGAAAGGGGGTGGAAGG - Intergenic
995945105 5:117635603-117635625 AAGACTGGGAAGGAGGTGGGAGG - Intergenic
996583534 5:125058537-125058559 AGGACTGGAAAGGGGGAGGAGGG + Intergenic
997507595 5:134430303-134430325 GAGACTGGCCAGGGGCTGGTTGG + Intergenic
998064918 5:139150383-139150405 AAGACAGGGAAGGGAGAGGAGGG - Intronic
998069001 5:139181999-139182021 AAGGCAGAGAAGGGGGTGGAAGG + Intronic
998078849 5:139258144-139258166 AAAACAGGGAAGGAGGTGGAAGG + Intronic
998135878 5:139674267-139674289 AAGCTGGGCAATGGGGTGGAAGG - Intronic
998349445 5:141491402-141491424 CAGACGGGGACGGGGGTGGAGGG + Exonic
998671051 5:144354458-144354480 TAGGCTGGCCAGAGGGTGGAAGG - Intronic
999240038 5:150122092-150122114 ATGAGTGGCAAGGGGCAGGAGGG - Intronic
999595726 5:153202064-153202086 AAGAGTGATAAGGGGGTGGATGG - Intergenic
999998260 5:157113051-157113073 ACCAATGGCAAGGGGGTGGAGGG - Intronic
1000649397 5:163797574-163797596 AAGAGTGGCATGGGGGGTGAGGG - Intergenic
1001134299 5:169089759-169089781 AACACTGGCAAGTGTGTGAAGGG - Intronic
1002154936 5:177269771-177269793 AAGATGGGCAAAGGAGTGGATGG + Exonic
1002338325 5:178495659-178495681 GAGAGTGGGAAGGGGGAGGAAGG + Intronic
1002550008 5:179981053-179981075 AAGACTGGGAAGGGGTTAGATGG + Intronic
1004727590 6:18326190-18326212 AAGACTGGAGAGGAGATGGAAGG + Intergenic
1005391839 6:25341914-25341936 AACACTGGAAAGGCGGAGGAGGG + Intronic
1005640001 6:27786886-27786908 AAGTCTGGCCAGGGGCTGGGGGG + Intergenic
1006551276 6:34825258-34825280 AATACTTCCAAGGGGGTGAAAGG + Intronic
1006558578 6:34889572-34889594 CAGACTGGAGAGGGGGTGGCTGG - Exonic
1007171910 6:39870092-39870114 AGAACTGGCAAGGGGCTTGAAGG + Intronic
1007202235 6:40119489-40119511 AAAAGTGGAAAGGTGGTGGATGG - Intergenic
1007342362 6:41199641-41199663 AAGGCAGGCAGAGGGGTGGAGGG - Intronic
1007387180 6:41528025-41528047 AGGGCTGGTATGGGGGTGGAGGG - Intergenic
1008367927 6:50704417-50704439 AAGACTGGAAAAGGGATGGGTGG + Intergenic
1011784892 6:90832706-90832728 AATACTGTCATGGGGGTGTAGGG - Intergenic
1013273044 6:108560306-108560328 CCGACTGGGAAGGGGGCGGAGGG + Intronic
1013480332 6:110547432-110547454 AAATGTGGCATGGGGGTGGAGGG - Intergenic
1014783788 6:125594674-125594696 TAGACTGGGATGGGGGAGGATGG + Intergenic
1015790069 6:136957648-136957670 AGGAAAGGCAGGGGGGTGGAAGG - Intergenic
1016992962 6:149942374-149942396 GAGGCTGGCAGGAGGGTGGAGGG + Intronic
1017005373 6:150025148-150025170 GAGGCTGGCAGGAGGGTGGAGGG - Intronic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020940118 7:14522601-14522623 ACAACTGGAAAGGGGGTGGATGG + Intronic
1021458069 7:20851262-20851284 AAGAATGACAAATGGGTGGATGG + Intergenic
1021494360 7:21258071-21258093 GAGAATGGAAAGGGGGAGGAAGG + Intergenic
1025021547 7:55484343-55484365 AAGACTGGCAAGGGGGTGGAAGG - Intronic
1025110740 7:56214097-56214119 AAGAGTGGGAAGGGGGTGAGGGG - Intergenic
1025985664 7:66449167-66449189 AAGACTGGCAAGGGTCTTAAGGG + Intergenic
1026308767 7:69166144-69166166 AAGAGGGGAAAGGGGGGGGAAGG + Intergenic
1026650218 7:72210049-72210071 AAGCCTGGGAAGGGCCTGGAAGG - Intronic
1028767689 7:94578552-94578574 GAGACTGGCAAATGGGTGGGGGG - Intergenic
1029505284 7:100960174-100960196 AAGACTGTTAATGGGGTGGTGGG - Exonic
1029978105 7:104852847-104852869 GGGACTGGGAAGAGGGTGGAGGG - Intronic
1031923443 7:127617825-127617847 AAAACAGGAAAGGGGGTGGAAGG + Intergenic
1032467611 7:132156272-132156294 AAGTCTGGCGAGGGAGTAGAGGG + Intronic
1032853249 7:135813147-135813169 AAGAGTGGCTAGGTGGTGGGTGG - Intergenic
1033009568 7:137605799-137605821 AAGACTGGGAAGGGTGTGGTGGG + Intronic
1033261144 7:139845044-139845066 AAGACTGGCCAGACTGTGGAGGG - Intronic
1034479628 7:151309303-151309325 ACGATTGGCAAGGAGGTGGGAGG - Intergenic
1034493686 7:151407947-151407969 AAGACTGTCTTGGGGGTAGAGGG - Intronic
1034781546 7:153886788-153886810 AAGTCTGGCGAGGGAGCGGAGGG - Intergenic
1035892441 8:3359585-3359607 GAGGCTGGGAAGGGGGTGTATGG + Intronic
1038328615 8:26590696-26590718 AACTATGCCAAGGGGGTGGATGG - Intronic
1038340573 8:26682042-26682064 AGGAGTGGGAAGAGGGTGGAGGG - Intergenic
1039266219 8:35826979-35827001 AAGCCTGGAGTGGGGGTGGAGGG - Intergenic
1040653947 8:49482526-49482548 AAGAATGGCAAGGTTTTGGAAGG - Intergenic
1042953021 8:74220551-74220573 AAGAATGTTAAGGGGGTGGGTGG - Intergenic
1044307671 8:90656795-90656817 AGGACTGCACAGGGGGTGGAAGG + Intronic
1045974845 8:108120659-108120681 AAGAATTGCCAGAGGGTGGATGG - Intergenic
1047458723 8:125041237-125041259 AAGACTGGCAAAGGGGAGTGAGG + Intronic
1047590511 8:126321981-126322003 AAGCCTGGAAAGATGGTGGAAGG - Intergenic
1047921401 8:129638414-129638436 TAAACTGGCAAGGGGGTGGTGGG - Intergenic
1049037964 8:140091359-140091381 AAGACTGGCAGGAAGATGGATGG + Intronic
1049203854 8:141354325-141354347 AAGACTGGTAGGGGAGGGGAGGG + Intergenic
1049274466 8:141712895-141712917 GAGGCTGGCAAGAGGCTGGACGG + Intergenic
1049497990 8:142945680-142945702 GGGACTGGGAATGGGGTGGAGGG + Intergenic
1049615464 8:143573963-143573985 CAGACAGGCAAGGGTGTGGGGGG - Intergenic
1049802416 8:144524129-144524151 CAGACTGGCCAGGGGCTGCAGGG + Exonic
1050457402 9:5847074-5847096 AAGAATGCCCAGGGGATGGAGGG + Intergenic
1051112076 9:13650752-13650774 GAGCCTGTCAAGGGGGTGGGAGG - Intergenic
1051306903 9:15719381-15719403 AAGGCTGGCGGGGGGGTGGGGGG + Intronic
1052966222 9:34342654-34342676 ATGCCTGGGAAGGGGGTGCAGGG - Intronic
1055018169 9:71641464-71641486 ATGACTGGAGAGGGGGTGGGTGG + Intergenic
1055370783 9:75596587-75596609 AAGATAGGCAAGGGGGAGAAGGG - Intergenic
1056928396 9:90854154-90854176 CAGACTGGCCGGGTGGTGGAGGG + Intronic
1057314851 9:93961509-93961531 AGTCCTGGCAAGGTGGTGGAGGG - Intergenic
1058425435 9:104871492-104871514 CACACTGGCCAGGGCGTGGAAGG + Intronic
1058549338 9:106097216-106097238 GATACTGGCAAGGTTGTGGAGGG + Intergenic
1058781161 9:108336946-108336968 GAAAGTGGCAAGGGAGTGGAGGG + Intergenic
1059476659 9:114552875-114552897 AAGCCGGGGAAAGGGGTGGAGGG - Intergenic
1060115419 9:120936466-120936488 AAGGCTGGCAGGGGGCTGGCAGG - Intergenic
1061264614 9:129497763-129497785 AAGAATGACAAGGGGGTAGCGGG + Intergenic
1061503878 9:131019819-131019841 AAGACTGGGAGGGGGGCGGGTGG - Intronic
1061706519 9:132457293-132457315 AAGACGGGGACGGGGGTGGGGGG + Intronic
1061919152 9:133772619-133772641 GTGTCTGGCAAGGGGGTGGGTGG - Intronic
1062215562 9:135387638-135387660 AAGACAAGCAAGGGGACGGAGGG - Intergenic
1062577793 9:137216667-137216689 TTGACTGGGAAGGGGGTGGGGGG - Exonic
1062733078 9:138120254-138120276 ACGCCTGGCTAGGGGGTGGGCGG - Exonic
1203751036 Un_GL000218v1:80679-80701 AGTACTTGCCAGGGGGTGGAAGG + Intergenic
1185596245 X:1308684-1308706 GAGGCTGGCGTGGGGGTGGAAGG - Intronic
1188380815 X:29489343-29489365 AAGAAAGGCAAGGGGGTAAAAGG + Intronic
1189197794 X:39166513-39166535 AAGAAGGGCATGGGGGTCGAGGG + Intergenic
1189865590 X:45323805-45323827 AAGAGTGGGAAGGGTGGGGATGG - Intergenic
1192221017 X:69197386-69197408 AAGATTGGCAAGCAGGTTGATGG + Intergenic
1194837793 X:98702588-98702610 TAGACTGGGAAGGGTGGGGAGGG - Intergenic
1195544526 X:106100334-106100356 CACACTGGCAAGGGCGTGGCTGG + Intergenic
1196720511 X:118849327-118849349 AAGACTGGCCAGAAGGTAGAAGG + Intergenic
1196755618 X:119154985-119155007 AAGGCTGGCAAAGGTGTGGGTGG + Intergenic
1198022114 X:132669306-132669328 GAGATTGGCCAGGGGGTGGTGGG - Intronic