ID: 1025022073

View in Genome Browser
Species Human (GRCh38)
Location 7:55488096-55488118
Sequence TGCCAGCATCCTGATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025022062_1025022073 11 Left 1025022062 7:55488062-55488084 CCTCTCTACCCAGGAAAACATAT 0: 1
1: 0
2: 1
3: 17
4: 213
Right 1025022073 7:55488096-55488118 TGCCAGCATCCTGATGGGGAAGG 0: 1
1: 0
2: 3
3: 15
4: 228
1025022067_1025022073 2 Left 1025022067 7:55488071-55488093 CCAGGAAAACATATTGGTGGGAC 0: 1
1: 0
2: 5
3: 62
4: 175
Right 1025022073 7:55488096-55488118 TGCCAGCATCCTGATGGGGAAGG 0: 1
1: 0
2: 3
3: 15
4: 228
1025022066_1025022073 3 Left 1025022066 7:55488070-55488092 CCCAGGAAAACATATTGGTGGGA 0: 1
1: 0
2: 3
3: 25
4: 188
Right 1025022073 7:55488096-55488118 TGCCAGCATCCTGATGGGGAAGG 0: 1
1: 0
2: 3
3: 15
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025022073 Original CRISPR TGCCAGCATCCTGATGGGGA AGG Intronic
901217636 1:7563554-7563576 TGCTAACACCCTGATGTGGAAGG - Intronic
901441088 1:9278917-9278939 TACCAGAATCCCCATGGGGAGGG - Intergenic
901631659 1:10651067-10651089 TGCCCGCTTCCTGCAGGGGAGGG + Exonic
901722043 1:11206813-11206835 TGCCAGCTTACTCATGGTGAAGG + Intronic
901796882 1:11684687-11684709 TGCCATCAGCCTGGTGGGGATGG - Intronic
902843762 1:19093235-19093257 TGCCAAGATGCTGATGGAGAAGG + Intronic
903326178 1:22569838-22569860 TGCCCCCATCCTCCTGGGGAAGG + Intronic
903370013 1:22829396-22829418 TGCCTGCAGCCTGATGGGGTCGG + Intronic
905016157 1:34780344-34780366 TGGCAGCATCCAGATGAGGAAGG - Intronic
906669363 1:47643477-47643499 CACCAGCATCCTGAGGTGGAAGG - Intergenic
907319032 1:53591264-53591286 TGCCAGCATCATGGAGGAGAGGG + Intronic
908252265 1:62274512-62274534 TGCCTTCACCCTGAAGGGGAGGG + Exonic
909043055 1:70676486-70676508 CTGAAGCATCCTGATGGGGAAGG + Intergenic
909561777 1:77015964-77015986 TCCCAGCATCCTGAAAGGCAGGG + Intronic
912487658 1:110041762-110041784 TGCCATCATGCTGTTTGGGATGG + Exonic
913230596 1:116737683-116737705 GGACAGCATCGTGATGGTGAGGG - Intergenic
914704958 1:150162832-150162854 GGCTAACAACCTGATGGGGAAGG - Intronic
916850089 1:168694926-168694948 TCCCAGCATTGTGATGGGGAAGG - Intergenic
917504767 1:175617502-175617524 TGCAAGAATCCTGCTGTGGAAGG - Intronic
919120523 1:193334571-193334593 AGCCACCCTCCTGATGGGAATGG - Intergenic
920030509 1:203034762-203034784 TGCCATCACCCTGATGAGGGTGG + Intronic
920364384 1:205440375-205440397 TGCCAGCATCCTCCTGGGCCAGG - Intronic
920792038 1:209102310-209102332 TGCCAGCCTCATGATTGTGAGGG - Intergenic
921828420 1:219700168-219700190 TTTCAGCAGCGTGATGGGGATGG - Intronic
922796686 1:228343031-228343053 TGCCAGGAACCTGCTGGGGAGGG + Intronic
923035825 1:230284563-230284585 TGCCAGCCTCCTGAAGGGCGTGG + Intergenic
923038327 1:230301081-230301103 TGTCAGCAGCCTGGTGGTGAAGG - Intergenic
923094516 1:230763949-230763971 TGCTTGCATCCTGATGTGGGGGG - Intronic
1067094222 10:43287731-43287753 TGACAGCATCCAGATTGGAAAGG + Intergenic
1067277551 10:44848685-44848707 TGCCAGCATCCCCATAGAGAGGG - Intergenic
1068113300 10:52706985-52707007 TGCCACCATCCTGGGAGGGAGGG - Intergenic
1069687872 10:70330671-70330693 GGCATGCATCCTGATGGGGTGGG + Intronic
1069717652 10:70531266-70531288 TGCCAGGAGCCCGAGGGGGAAGG - Intronic
1069751022 10:70745047-70745069 TCCCAGCACCCTCATGGAGAAGG + Intronic
1069782746 10:70967064-70967086 TGCCAGCTACCAGATGGGGGAGG - Intergenic
1073114837 10:101085940-101085962 TGCCCGCACCTTGATGAGGACGG + Intergenic
1074895206 10:117771421-117771443 TGCCAGCATTCTCAGGGGGAAGG + Intergenic
1074974621 10:118569963-118569985 TGACCTCACCCTGATGGGGAAGG - Intergenic
1074975004 10:118572854-118572876 TGACCTCACCCTGATGGGGAAGG - Intergenic
1075760168 10:124849511-124849533 TGCCAGCCTCCGGATGAAGAAGG - Intergenic
1075958543 10:126546442-126546464 TGGCACCATCCTGGTGGGGAGGG - Intronic
1077392494 11:2306682-2306704 TGATAGCTTCCAGATGGGGATGG + Intronic
1077483821 11:2829921-2829943 TGCCAATACCCTGGTGGGGAGGG + Intronic
1078427685 11:11265128-11265150 TCCCTGCATGCTGATGGGGCTGG + Intergenic
1079222018 11:18571422-18571444 TGCAAGAATACTGCTGGGGAGGG - Intronic
1084035834 11:66509770-66509792 TGTCAACATCCTGTTGTGGAAGG - Intronic
1084537178 11:69764089-69764111 GGCCGGCACCCTGATGGGCAAGG - Intergenic
1088133860 11:106529239-106529261 TACCAGCATCCTCAAGGGAAGGG + Intergenic
1088481278 11:110298046-110298068 TGCCTGCAACCTGATGTGGTAGG - Intergenic
1090951017 11:131473363-131473385 TGTATGGATCCTGATGGGGAGGG + Intronic
1091268370 11:134288298-134288320 TGCCCCCATCTTGATGCGGAGGG + Intronic
1091785321 12:3239772-3239794 CGACAGGGTCCTGATGGGGAAGG + Intronic
1092763617 12:11832178-11832200 TGTCAGCCTGCTGATGGGGTTGG + Intronic
1095160151 12:38905868-38905890 AGCAAGCAGCCTGATGGAGAAGG + Intronic
1095826236 12:46532306-46532328 TGCCAGTGTTCTGATGGGGGCGG + Intergenic
1096536896 12:52280642-52280664 TGCCACCCTCCTGAGGGGTAGGG + Intronic
1096995991 12:55838576-55838598 TGCCAACAGCCTGGAGGGGAGGG + Intronic
1097778045 12:63669925-63669947 TGACAGCATTCAGATGGGCAGGG - Intergenic
1098865412 12:75757234-75757256 TATCAACATCCTGAAGGGGAAGG + Intergenic
1100363351 12:93897831-93897853 TGACAGCAACCTGTGGGGGAAGG - Intergenic
1102044596 12:109822029-109822051 AGCCAGAATCCTGATGGGGAGGG + Intronic
1102606701 12:114073339-114073361 TCCCAGCATTCAGAGGGGGAAGG + Intergenic
1104226079 12:126835021-126835043 ATCCAGCATGATGATGGGGATGG + Intergenic
1106581853 13:31025838-31025860 TGTTAGCCTCCTGATGGAGAAGG + Intergenic
1107449905 13:40498849-40498871 AGCCAGAATTCTGAAGGGGAAGG - Intergenic
1108455132 13:50605462-50605484 TGCCAGCAGCTTGAAGGGGAGGG + Intronic
1108510999 13:51155883-51155905 TACCAGAATCCAGATGGGAATGG + Intergenic
1110250199 13:73372568-73372590 TGGGAGCCTCCTGATGGGGCTGG + Intergenic
1112096914 13:96143819-96143841 TAGCAGCATCCTAATGGGGTTGG + Intronic
1112170003 13:96961666-96961688 TGCCAGCTTCTTGCTGGGGCCGG - Intergenic
1112579990 13:100670178-100670200 TTCCAGCCCCCTGATTGGGAAGG + Intronic
1114850497 14:26377529-26377551 TGTCACCACCCTGATGGGAATGG + Intergenic
1121586652 14:95067574-95067596 TTCCAGCAGCATGAGGGGGAGGG + Intergenic
1122863509 14:104593262-104593284 TGCCGGCTCCCTGATGAGGATGG - Exonic
1124162262 15:27283191-27283213 TGCCAGCACCATGAAGGGGTTGG + Intronic
1124338342 15:28873780-28873802 TGCCAGCGTTCTGCTGGTGAGGG + Intergenic
1127328569 15:57917834-57917856 GGTCACCATCCTGTTGGGGAGGG + Intergenic
1128316572 15:66662999-66663021 TGCCAGCACTCTGGTGGGGTCGG - Intronic
1130287199 15:82565885-82565907 TGCCAGCATGTGAATGGGGATGG - Intronic
1130661360 15:85833743-85833765 GGCCAGTGTCCTCATGGGGAAGG + Intergenic
1130670294 15:85906222-85906244 ACACAGCATCCTGATGGGCAGGG - Intergenic
1131273308 15:90959948-90959970 TGCCAGGTTCCTGGTGGGCAGGG - Exonic
1132011975 15:98284098-98284120 GGTCAGCCTCCTGATGGGCATGG - Intergenic
1132630197 16:913590-913612 TGCATGAATCCTGAGGGGGAGGG - Intronic
1133279927 16:4659476-4659498 GGCCAGCTTCCTGAGGGGTACGG + Intronic
1140034450 16:71361619-71361641 AGCCAGCATCCAGAAGGGGTGGG - Intronic
1141236852 16:82226534-82226556 TGTCAGCATTCTGACAGGGACGG + Intergenic
1141608311 16:85168108-85168130 CGCCAGTCTGCTGATGGGGACGG - Intergenic
1141990410 16:87606028-87606050 TCCCAGCTTCCTGTTGGGAAGGG + Intronic
1142102764 16:88284332-88284354 TCCCAGCCTCCTGAAGTGGATGG + Intergenic
1143387316 17:6538920-6538942 TGCCAGCATCCTGCAGGGTAGGG - Intronic
1144524910 17:15981030-15981052 TGACAGCATCCTGGTGAGGATGG - Exonic
1145264207 17:21371762-21371784 TGCCTGCCTCCTGATGGGGCAGG + Intergenic
1147883166 17:43666761-43666783 TCTCAGCATCCTCATGCGGACGG - Intergenic
1148368171 17:47072247-47072269 TGCCAGCTTCCTCCTGGGAATGG - Intergenic
1148732765 17:49847576-49847598 TCCCATCAACCTCATGGGGAAGG - Intronic
1149536423 17:57437082-57437104 TTCCATCTTCCTGATGAGGAGGG + Intronic
1152338173 17:79709713-79709735 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1152338200 17:79709800-79709822 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1152338241 17:79709931-79709953 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1152338256 17:79709975-79709997 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1152338285 17:79710063-79710085 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1152338328 17:79710194-79710216 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1153448008 18:5195931-5195953 AGCTAGCATTCTGAGGGGGAGGG + Intronic
1154207736 18:12352188-12352210 TGCCAGGGTCCTGAGGGTGAAGG - Intronic
1155419175 18:25635682-25635704 CGCCAACATCCACATGGGGATGG - Intergenic
1160870717 19:1276516-1276538 TGCCAGGGTGGTGATGGGGAGGG - Intronic
1162013446 19:7831103-7831125 AGCCAGGATCCAGATGGGGCAGG - Intronic
1162925853 19:13930229-13930251 TTGCAGCATCCTGTGGGGGATGG - Exonic
1164962170 19:32443008-32443030 TGACACCATCCTGATAGAGAGGG - Intronic
1166976808 19:46609646-46609668 TCCCAGCAGCCTGTTGGGGCAGG + Exonic
929134619 2:38611652-38611674 TGGCAGCTTCCTGATCGTGATGG - Intergenic
934859237 2:97749929-97749951 TGGCAACTTCCTGATGGGGATGG - Intergenic
935898891 2:107769283-107769305 ATCCAGCATCCTCATGAGGAAGG + Intergenic
937908855 2:127065642-127065664 TGGCTGCATCCTCATGGAGAGGG - Intronic
938604136 2:132874773-132874795 TCCCTGCATACTGATTGGGAAGG + Intronic
938711973 2:133982692-133982714 TGCCAGCATCATGACAGTGAAGG - Intergenic
939520907 2:143229564-143229586 TGACAGCCTCCTGATTAGGAAGG + Intronic
945273127 2:207961801-207961823 TGACAGCATCCACCTGGGGAAGG - Intronic
946177027 2:217928356-217928378 GGCCAGCTGCCTGGTGGGGAGGG - Intronic
948465999 2:238151905-238151927 TGGCAGCCTCCTGAGGGTGAGGG + Exonic
1168771569 20:419838-419860 TGCCAGCAGCATGGTTGGGAGGG - Intronic
1170140700 20:13122830-13122852 TTCCTCCATCCTTATGGGGAGGG - Intronic
1172790746 20:37503723-37503745 TGCCAACATCCTGAGAGCGAGGG - Intronic
1173121757 20:40298092-40298114 TGCCAGAATTTTGATTGGGATGG - Intergenic
1173201044 20:40955331-40955353 AGCCACCAACCTGGTGGGGAGGG + Intergenic
1174195218 20:48767999-48768021 TGCCAGCTCCGTGATGGTGAGGG + Intronic
1178439130 21:32584296-32584318 TGCCAGCATCCTGGTTGGGAAGG + Exonic
1178640734 21:34343068-34343090 TGGCTGCTTCCAGATGGGGAGGG + Intergenic
1179655943 21:42844851-42844873 TGCCAGCCTCATGGTGGGGGCGG - Intronic
1180839419 22:18952214-18952236 TGCCAGCAACCTGCAGGGGTGGG + Intergenic
1181062481 22:20288270-20288292 TGCCAGCAACCTGCAGGGGTGGG - Intergenic
1181110393 22:20599298-20599320 TGCCAGCCTCCTGCTGTGGCTGG + Intergenic
1181559708 22:23692945-23692967 TGCCAGCAGCCTGGGAGGGAAGG - Exonic
1183366929 22:37411795-37411817 TGCCAGGCTCCTGGAGGGGATGG - Intronic
1183738157 22:39655221-39655243 TGCCATTATTATGATGGGGATGG + Intronic
1184041221 22:41945246-41945268 TGCCAGCTTCTTCTTGGGGAAGG - Exonic
1184278617 22:43425006-43425028 TGCCAGCGTCCTGAAGGCGGAGG + Exonic
1184694083 22:46130227-46130249 TGCCAGCCTCCCGATGAGGCCGG - Intergenic
1184699641 22:46162040-46162062 TGCCAGCCTCCTGCTAGGGCTGG + Intronic
1184700845 22:46171631-46171653 TGGGAGCATCCTGACAGGGAGGG + Intronic
1185070495 22:48653230-48653252 TGCCTGGATCCAGATGGGGTTGG + Intronic
950174646 3:10864454-10864476 TGCCAGGAACCTGGTGAGGAAGG - Intronic
950401870 3:12775285-12775307 TTCCAGCATCCTGCTGAGGTGGG + Intergenic
950457582 3:13101872-13101894 TCCCAGGATCTGGATGGGGAAGG - Intergenic
951519950 3:23602167-23602189 TGTCTGCATCCTTTTGGGGACGG - Intergenic
952956450 3:38560731-38560753 TACCAGCAACTTGATGGGAAAGG + Intronic
954334916 3:49910621-49910643 CCCCAGCTTCCTGATGGGGGCGG - Exonic
956772909 3:72541665-72541687 TGCCAGCAGCCTGAGGGGGCTGG - Intergenic
959780920 3:110232452-110232474 TGTTAGCAGGCTGATGGGGAAGG - Intergenic
960085259 3:113583600-113583622 TTCCATCATCATGATGGGAAAGG + Intronic
961075150 3:123975531-123975553 TGCCAGCAACCTGCAGGGCAGGG + Exonic
961170332 3:124793300-124793322 TTTCAGGATCCTGAAGGGGAAGG + Intronic
961308545 3:125976991-125977013 TGCCAGCAACCTGCAGGGCAGGG - Exonic
962383066 3:134912444-134912466 TCCCAGCATGCTGATGGTGCAGG - Intronic
964310023 3:155382643-155382665 TGTCAGCTTCCTGATGGGCTGGG - Intronic
964381622 3:156103491-156103513 TGCCATTTTCCAGATGGGGATGG - Intronic
965147719 3:164927941-164927963 TGCCAGCATCCATATGGTGGTGG + Intergenic
966068579 3:175846716-175846738 TGGCAGAAACCTGATGGGCAGGG + Intergenic
966629775 3:182059533-182059555 TGGCAGCATGGTGATGGGGCAGG - Intergenic
967968898 3:194985022-194985044 TGCCAGCCTCCCGAGGGAGATGG + Intergenic
968123621 3:196143080-196143102 TTCCAGCACCCTGATGGCCATGG - Intergenic
968135590 3:196217418-196217440 TCCCAGCTTACTCATGGGGATGG + Intronic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
970050136 4:11905158-11905180 CGCCAGCATTCTGCAGGGGAAGG + Intergenic
972687331 4:41363348-41363370 TGGCAGCATCCTCATTGGTAGGG + Intronic
974193638 4:58540570-58540592 TGCCAGGACCATGACGGGGAGGG + Intergenic
980146761 4:128995639-128995661 TGCCAGCATCTCCCTGGGGAGGG - Intronic
982089873 4:151871294-151871316 TGCCAGGGTCCTGATGATGAAGG - Intergenic
984388567 4:179097289-179097311 TGCCAGCTTTTGGATGGGGAGGG - Intergenic
985783381 5:1882177-1882199 GGCGAGCATCCTGGTGTGGACGG - Intronic
987333454 5:16877088-16877110 TGCCAGCATCTTGATGGCCTTGG + Intronic
988018738 5:25596267-25596289 GGCCATCATCCAGGTGGGGAGGG + Intergenic
989952526 5:50316537-50316559 AGCCAGCATCCTGACAGGCATGG + Intergenic
993327779 5:86563883-86563905 GGCCATCACCCTGAGGGGGAAGG + Intergenic
995485246 5:112633627-112633649 TGCCACCATCCTCCTGGGCAGGG + Intergenic
998506566 5:142677270-142677292 TCCCATCAGACTGATGGGGAAGG + Intronic
1000504466 5:162097801-162097823 TCTCAGCATCCTGTTGGGGGTGG - Exonic
1002192260 5:177484439-177484461 TGCCATCCGCGTGATGGGGATGG - Intronic
1003449906 6:6221026-6221048 TACAAGCATCCAAATGGGGATGG - Intronic
1003989935 6:11476249-11476271 TGCAAGCACCCTGAAGTGGAAGG + Intergenic
1004084869 6:12436860-12436882 TACCAGCATTCAGCTGGGGAAGG + Intergenic
1005200521 6:23339445-23339467 CGCCAGCAGCCTCATGGGGGTGG - Intergenic
1006640829 6:35488855-35488877 TGCCACCATGCTGAGGGGGGAGG - Intronic
1006686016 6:35834888-35834910 TGCCAGCATAAGGATGAGGAGGG - Exonic
1007631816 6:43276985-43277007 TGCCAACTTCCGGGTGGGGATGG + Intronic
1008602752 6:53111896-53111918 TGCCAGCGTTTTGATTGGGAAGG - Intergenic
1010062062 6:71635037-71635059 TGCCTGCAGCCTGGTGGGGGAGG + Intergenic
1010855975 6:80840070-80840092 TGCCAACATGCTTATAGGGAAGG + Intergenic
1012213251 6:96550643-96550665 GGCCAGCACCTTGCTGGGGAAGG - Intronic
1012640820 6:101610934-101610956 GGCCTGCATACTGATTGGGAAGG - Intronic
1015794886 6:137001688-137001710 TGCGAGCCTTCTGAGGGGGATGG - Exonic
1016438925 6:144064267-144064289 TGCCTGCGTCCTGCCGGGGATGG - Intronic
1018794027 6:167172131-167172153 CTCCAGCATCCTGGTTGGGAAGG - Exonic
1018822307 6:167382946-167382968 CTCCAGCATCCTGGTTGGGAAGG + Exonic
1019165754 6:170096601-170096623 TGCGAGCACGTTGATGGGGAAGG + Intergenic
1019548081 7:1587985-1588007 TCACAGCCACCTGATGGGGAAGG + Intergenic
1020972012 7:14955607-14955629 TTCCAGCATCTTGTTGGGCAGGG - Intronic
1023283740 7:38596815-38596837 TGCCAGCACCCTGAGGTAGATGG + Intronic
1023642648 7:42275902-42275924 TGCCAAAATCCTGATAGGTAGGG + Intergenic
1023662907 7:42488858-42488880 TGTCACCATCATGATGGGTAGGG - Intergenic
1025022073 7:55488096-55488118 TGCCAGCATCCTGATGGGGAAGG + Intronic
1028373150 7:90117990-90118012 TGACAGCATTCAGATGGGCAGGG + Intergenic
1029435258 7:100560561-100560583 TGCCAGCTTCCTCCTGGGCAAGG - Intronic
1029833209 7:103281697-103281719 TGACAGCATTCAGATGGGCAGGG - Intergenic
1030651901 7:112125242-112125264 TGGGATCATCCTGATGGGGCAGG - Intronic
1036446874 8:8829208-8829230 TGCCAGACTCAGGATGGGGAAGG - Intronic
1037381688 8:18292142-18292164 TCCCAGCTTCCTGATGAGGCAGG - Intergenic
1038730938 8:30127212-30127234 TGCCAGCATCCTGAGCTTGATGG + Intronic
1038869313 8:31476894-31476916 TGCCCACATCCTGAGTGGGATGG - Intergenic
1038935111 8:32241364-32241386 AGCCAACATACTGAGGGGGAAGG - Intronic
1040474509 8:47764546-47764568 CGCCAGGGACCTGATGGGGACGG - Intergenic
1040516238 8:48137368-48137390 TGGCAGCAACCTGAAGGAGATGG + Intergenic
1042785261 8:72538103-72538125 TCCCAGCAGCCTGACTGGGAAGG + Intronic
1045324764 8:101109902-101109924 AGCCAGCGTCCTGAGGGGGCAGG + Intergenic
1046281271 8:112035438-112035460 TACCAGGATCATGATGGGAAGGG + Intergenic
1049217488 8:141414874-141414896 GGGCAGCATCCTGATGGGGGAGG + Intronic
1049337055 8:142092192-142092214 TGCCGGCAACCTGATGAGGGAGG + Intergenic
1049417824 8:142503601-142503623 TGCCAGCCTCCTGCTGGGGAGGG + Intronic
1049654924 8:143793196-143793218 ACCCACCATCCTGCTGGGGAAGG + Intronic
1049658373 8:143808811-143808833 GGCATGCAGCCTGATGGGGAGGG - Exonic
1049663881 8:143834402-143834424 TGCCAGCAGCCTGAAGGAGCAGG + Exonic
1051108733 9:13610610-13610632 TTCAGGCATCCTGATGAGGAAGG + Intergenic
1051557817 9:18404660-18404682 TGCCAGGATCCTGACAGGGGAGG - Intergenic
1055935723 9:81602734-81602756 TGACAGCAATCTGATGAGGAAGG + Intronic
1056492824 9:87124875-87124897 TTCCAGCCTCCTCAAGGGGATGG + Intergenic
1056928564 9:90855315-90855337 TGCAAGCCACCTGCTGGGGAGGG + Intronic
1057035043 9:91805838-91805860 TACCTGCACCCTCATGGGGAGGG - Intronic
1057527018 9:95811782-95811804 TGGGAGCATCCTGATCTGGAGGG + Intergenic
1059023999 9:110605050-110605072 TGCCAGCATCTGCATGGGGCAGG - Intergenic
1061791915 9:133063508-133063530 TGCCAGGTTCCAGGTGGGGAAGG - Intronic
1062100381 9:134724933-134724955 TGCCATCCTCCAGATGGGGTTGG + Intronic
1062363250 9:136197433-136197455 TGCCAGCACCCTCATGGGTGGGG + Exonic
1062589210 9:137265903-137265925 TGCCAGCGTGTTGATGGCGAAGG - Exonic
1186876933 X:13826304-13826326 TCTCAGCATCCTGAGGGGAATGG + Intronic
1187034006 X:15518659-15518681 TGGCAGCATGCTTTTGGGGAGGG + Intronic
1188886821 X:35561055-35561077 TGACAACATTCTGATGGGGGAGG - Intergenic
1189479793 X:41383796-41383818 TCACAGCATCCTTCTGGGGATGG + Intergenic
1190325577 X:49205072-49205094 TGCCTGCCTCCTGCTGGGGAGGG + Exonic
1192807675 X:74524523-74524545 CCCCAGCATTCTGATGAGGAAGG - Exonic
1197779772 X:130148022-130148044 TCACAGCATCCTGATGGGAGAGG + Intronic
1198937952 X:141918455-141918477 TGCCAGAATCCTTGTGGTGATGG + Intergenic
1200838549 Y:7756406-7756428 TGCCAGAACTATGATGGGGAAGG + Intergenic
1202272899 Y:23087632-23087654 TCCCAGGATCCTCCTGGGGAAGG + Intergenic
1202293127 Y:23333050-23333072 TCCCAGGATCCTCCTGGGGAAGG - Intergenic
1202425896 Y:24721376-24721398 TCCCAGGATCCTCCTGGGGAAGG + Intergenic
1202444893 Y:24948710-24948732 TCCCAGGATCCTCCTGGGGAAGG - Intergenic