ID: 1025022263

View in Genome Browser
Species Human (GRCh38)
Location 7:55489014-55489036
Sequence CTGAGCAGACAGCTGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 347}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025022260_1025022263 0 Left 1025022260 7:55488991-55489013 CCATGCCACAGATAGTCTGGGAT 0: 1
1: 0
2: 0
3: 16
4: 312
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022245_1025022263 30 Left 1025022245 7:55488961-55488983 CCCTCCTCTCAGTCCCCACGCCC 0: 1
1: 0
2: 6
3: 93
4: 853
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022246_1025022263 29 Left 1025022246 7:55488962-55488984 CCTCCTCTCAGTCCCCACGCCCC 0: 1
1: 0
2: 5
3: 86
4: 814
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022256_1025022263 7 Left 1025022256 7:55488984-55489006 CCAGGGCCCATGCCACAGATAGT 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022252_1025022263 15 Left 1025022252 7:55488976-55488998 CCACGCCCCCAGGGCCCATGCCA 0: 1
1: 0
2: 3
3: 59
4: 498
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022250_1025022263 17 Left 1025022250 7:55488974-55488996 CCCCACGCCCCCAGGGCCCATGC 0: 1
1: 0
2: 3
3: 44
4: 360
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022261_1025022263 -5 Left 1025022261 7:55488996-55489018 CCACAGATAGTCTGGGATCTGAG 0: 1
1: 0
2: 0
3: 28
4: 1454
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022253_1025022263 10 Left 1025022253 7:55488981-55489003 CCCCCAGGGCCCATGCCACAGAT 0: 1
1: 0
2: 2
3: 20
4: 227
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022259_1025022263 1 Left 1025022259 7:55488990-55489012 CCCATGCCACAGATAGTCTGGGA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022255_1025022263 8 Left 1025022255 7:55488983-55489005 CCCAGGGCCCATGCCACAGATAG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022251_1025022263 16 Left 1025022251 7:55488975-55488997 CCCACGCCCCCAGGGCCCATGCC 0: 1
1: 0
2: 2
3: 33
4: 418
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022247_1025022263 26 Left 1025022247 7:55488965-55488987 CCTCTCAGTCCCCACGCCCCCAG 0: 1
1: 2
2: 4
3: 61
4: 484
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347
1025022254_1025022263 9 Left 1025022254 7:55488982-55489004 CCCCAGGGCCCATGCCACAGATA 0: 1
1: 0
2: 2
3: 11
4: 197
Right 1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 40
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025022263 Original CRISPR CTGAGCAGACAGCTGCAGCA GGG Intronic
900105880 1:980826-980848 CTGGGCAGCTAGCTGCAGGAGGG - Exonic
900224253 1:1525355-1525377 CTGAACAGAGGGCTGCAGCCTGG - Intronic
900811370 1:4803797-4803819 CTGAGCAAACAGCTCAAGCATGG - Intergenic
900852057 1:5151693-5151715 CTGGGGAGGCAGCTGCAGCCAGG + Intergenic
901329309 1:8392720-8392742 CAGAGCAAACATCTGCTGCAAGG + Intronic
901629295 1:10640519-10640541 CTGTGCAGACAGGCGCAGCCAGG - Intronic
902125643 1:14208680-14208702 CTGAGAATAATGCTGCAGCATGG + Intergenic
902758426 1:18564959-18564981 CAGAGCAGCCAGCTGTAGAATGG + Intergenic
902760183 1:18575809-18575831 CTGAGCTGACAGCTGGTCCAGGG + Intergenic
903070347 1:20724090-20724112 CCGAGCCGACAGCTGCAGCTGGG + Exonic
904930968 1:34087206-34087228 ATGAGCAGAGAGCTGAATCATGG - Intronic
906144416 1:43551376-43551398 CTTTGCAGACAGCTGCAGTCGGG + Intronic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
907937618 1:59056948-59056970 CTGATGAGACAGCTGCAGTTTGG + Intergenic
908467633 1:64413672-64413694 CTTAGCAGAAAGCAGCAGCTAGG - Intergenic
910229633 1:84972993-84973015 CTTTGGAGACAACTGCAGCAGGG - Intronic
910876671 1:91885372-91885394 CTGAGCCGCAAGCTGCAGCTCGG - Intronic
911177717 1:94833593-94833615 CAGAGCAGAGAGCTACAGCTGGG - Intronic
911884019 1:103274638-103274660 CTGAGCACACACCTTGAGCAGGG + Intergenic
916202516 1:162285439-162285461 CTGAGCAGAATGCTGCAGTCAGG + Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
920051057 1:203165384-203165406 CTGGGCAGCCAACGGCAGCATGG + Exonic
920813839 1:209312245-209312267 CTGAGCAGACATCTCCATGAGGG - Intergenic
921150547 1:212398938-212398960 CTGAGCAGTCAGCTGTAGCTGGG + Intronic
921339468 1:214120313-214120335 CTGAACAGCCACATGCAGCAAGG + Intergenic
922565347 1:226597940-226597962 CTGAGCAGTGAGCTGCCCCAGGG + Intronic
922588462 1:226753796-226753818 CTGAGCAGAGATCTGAAGGATGG + Intergenic
922606144 1:226891148-226891170 ATGAGCAGATACCTGCAGGATGG + Intronic
922934212 1:229411289-229411311 CTCTGCAGACAGCTGCAGGCAGG + Intergenic
922963365 1:229666863-229666885 TTGGACAGACACCTGCAGCAGGG + Intergenic
923622424 1:235589413-235589435 CAGAGCAGACAGCTGAGTCAAGG + Intronic
924264599 1:242268785-242268807 CTGTGCAGAGATCTGCAGTAAGG + Intronic
1063977916 10:11431740-11431762 CTGAGCAGACAGAGGCATGATGG + Intergenic
1065186587 10:23174846-23174868 TATAGCAGACACCTGCAGCACGG - Intergenic
1066433331 10:35373337-35373359 CATTGCTGACAGCTGCAGCATGG - Intronic
1067027736 10:42858895-42858917 CGGAGCAGAGAGCTGCAGACTGG - Intergenic
1067089173 10:43257905-43257927 CGAGGCAGACAGCTGCAGCCTGG + Intronic
1067291595 10:44947565-44947587 CTGAGCTGACAGCAGCAGACAGG - Intergenic
1068443819 10:57095122-57095144 CCAAGCAGGCACCTGCAGCAGGG - Intergenic
1068474296 10:57506545-57506567 CAGAGACGCCAGCTGCAGCAAGG + Intergenic
1068669718 10:59710234-59710256 CTGAGCATACAGCTCCGGCCAGG - Intronic
1069411478 10:68158196-68158218 CTGAGCGCACAGCTTCAGGAGGG - Intronic
1069646975 10:70007457-70007479 CTTTACAGACAGCAGCAGCAGGG + Intergenic
1070855518 10:79605410-79605432 CTGAGCAGCTAGCAGCAGCAAGG - Intergenic
1071980790 10:91002883-91002905 CTGAGCTGCCAGCTGCCACATGG + Intergenic
1073690435 10:105802210-105802232 CTGATCATATAGCTGCAGGAAGG + Intergenic
1075455664 10:122583293-122583315 CTGAGCAGACGCCTGCACCATGG - Intronic
1075457787 10:122595996-122596018 CTGAGCAGACGCCTGCACCATGG - Intronic
1076678035 10:132158104-132158126 CTGAGTAGACAGATGCTGCCGGG - Intronic
1076769852 10:132656920-132656942 CTGGGCAGACAGCAGCGACAGGG + Intronic
1078821394 11:14886574-14886596 CAGGGCAGACAACTCCAGCAAGG - Intronic
1079119639 11:17672642-17672664 GTGTGCAGACAGCTGTAGTACGG - Intergenic
1079182220 11:18204030-18204052 ATACCCAGACAGCTGCAGCATGG + Intronic
1079331180 11:19534160-19534182 CTAAGCAGAGAGATGCAGTAAGG - Intronic
1079983871 11:27179803-27179825 CTGAGTAGGCTTCTGCAGCATGG + Intergenic
1080171244 11:29305700-29305722 CTGAGCAGCCAGCACCACCAAGG + Intergenic
1081765898 11:45610007-45610029 GTGAGCAGTCAGAAGCAGCATGG + Intergenic
1084118005 11:67053035-67053057 CTGCCCAGACAGCTCCAGCCTGG - Intergenic
1084502480 11:69543076-69543098 CTTAGCACACAACTGCGGCATGG - Intergenic
1084800420 11:71539874-71539896 CCGAGCTGACAGAGGCAGCAGGG - Intronic
1085435090 11:76493115-76493137 CGGAGCAGACAGCAGGAGCGGGG - Intronic
1085517011 11:77117463-77117485 CTGACCTGACACCTGCAGAAGGG - Intronic
1086666643 11:89491520-89491542 CGGAGCAGACTGGTGCAGCCTGG - Intronic
1088727409 11:112651803-112651825 GTGAGCAGACAGCCCCAGAAAGG - Intergenic
1089073498 11:115718592-115718614 CTGGGCTGACAGCTGGAGCCAGG + Intergenic
1089255538 11:117192169-117192191 CTGAGCAGCCAGCCCCAGGAAGG + Intronic
1090765852 11:129875606-129875628 CTGAGCTGCCAGCTGCTGGAGGG - Intronic
1090880750 11:130829960-130829982 GAGAGGAGCCAGCTGCAGCACGG - Intergenic
1091452722 12:583573-583595 CTGAGCAGCCAGGTCCAGCTTGG + Intronic
1091764054 12:3106837-3106859 TTGAGAAGCCAGCTGCAGCCTGG - Intronic
1093303657 12:17484276-17484298 GTGAAGAGACACCTGCAGCATGG + Intergenic
1095542759 12:43330020-43330042 ATCAGCAGAGAGCTCCAGCATGG - Intergenic
1096517317 12:52164169-52164191 CTGAGCAGTCAGCTCCAGAAGGG + Intergenic
1099387684 12:82036381-82036403 CTGAGCAGTAAGCAGCAGCTAGG - Intergenic
1099996702 12:89786618-89786640 CCAAGCAGACATCTGCTGCAGGG + Intergenic
1101234392 12:102774258-102774280 CTGAGCAGAGAGCAGCAGCAGGG + Intergenic
1103331353 12:120156449-120156471 CTGAGCACACACCCGGAGCACGG + Exonic
1104181518 12:126386249-126386271 CTGAACAGAGGGCTGCACCAGGG + Intergenic
1104299178 12:127548421-127548443 CGGAGCAATCAGCTGCAGCCTGG - Intergenic
1105444363 13:20439903-20439925 CTGAGAAAACAGCGGAAGCAGGG + Intronic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1106004716 13:25757924-25757946 CTGGGCTGGAAGCTGCAGCATGG - Intronic
1106033720 13:26025344-26025366 CCACGCAGGCAGCTGCAGCAGGG + Exonic
1106201919 13:27545274-27545296 CTGAGGAGGCTGCTGGAGCAAGG + Intergenic
1107228079 13:38075384-38075406 GTGAGCAGACAGCGGAAGAAAGG + Intergenic
1107710434 13:43145619-43145641 CTGAGGAGATAGCTGCAGAGTGG - Intergenic
1107905877 13:45060845-45060867 CTGAGCACACAGCTTCCGGAGGG - Intergenic
1108555178 13:51584612-51584634 CTGAGGAGACTGCTGGAGCACGG - Exonic
1108666923 13:52642078-52642100 CTGAGCAGACACCTCATGCATGG + Exonic
1109280397 13:60349078-60349100 CAGAGCAGACTGCAGCTGCAGGG + Intergenic
1109478759 13:62919738-62919760 CAGAGCAGACACCAGGAGCAGGG + Intergenic
1109478870 13:62920591-62920613 CTGAGCAGAGAGCTGGCTCAGGG - Intergenic
1109982199 13:69923857-69923879 CTGGGCCCACAGCTGCAGCTTGG - Intronic
1110064880 13:71091147-71091169 CTGACCAAACAGGAGCAGCAGGG + Intergenic
1110838297 13:80110379-80110401 ATGATCAGAGAGATGCAGCATGG + Intergenic
1112445872 13:99463571-99463593 GTGAGCACACAGCAGCAGGAAGG + Intergenic
1114327861 14:21607431-21607453 CTGAGCAAAGAGTTGAAGCAAGG + Intergenic
1114580060 14:23749139-23749161 GTGAGCAGATGGCTGCAGCAGGG - Intergenic
1118706749 14:68487087-68487109 CTGAGCAGACGAATACAGCAAGG - Intronic
1119484882 14:74980806-74980828 CAGCGCACACAGCTACAGCACGG + Intergenic
1119739452 14:77004816-77004838 CTGAGCAGACACCTGGACTATGG - Intergenic
1121404988 14:93714258-93714280 CTGAGCAGATATCTGTAGCCTGG - Intergenic
1121464946 14:94109742-94109764 CTCAGCAGACAGAGCCAGCAAGG - Intronic
1121581431 14:95035060-95035082 CAGAAAAGGCAGCTGCAGCAGGG + Intergenic
1122112807 14:99513824-99513846 TTGATCCCACAGCTGCAGCACGG - Exonic
1122289457 14:100672390-100672412 CAGAGCAGACAGCAGCAGAGGGG + Intergenic
1122329596 14:100903671-100903693 CTGAGCAGCCTTCAGCAGCAGGG - Intergenic
1122386218 14:101350083-101350105 CTGAGCAAACAGGGGCAGCCAGG - Intergenic
1122408413 14:101513733-101513755 CTAGGGAGACAGCAGCAGCATGG - Intergenic
1122961888 14:105097744-105097766 CTGAACAGAGAGCACCAGCACGG + Intergenic
1123427385 15:20183724-20183746 CGGAGCAGAGAGCTGCAGTCTGG - Intergenic
1123536621 15:21190274-21190296 CGGAGCAGAGAGCTGCAGTCTGG - Intergenic
1124360426 15:29032922-29032944 CTGATTGGCCAGCTGCAGCATGG + Intronic
1124593796 15:31077387-31077409 CTGAGCATCCAGCACCAGCAGGG - Intronic
1127136494 15:55929071-55929093 CCTAGCAGACAGATGAAGCAGGG + Intronic
1128367343 15:67013749-67013771 CTGATCAGACCCCTGCAGCCTGG + Intergenic
1129681664 15:77661759-77661781 CTGAGCAAACAGAGACAGCATGG + Intronic
1129753718 15:78083422-78083444 CAGAGCACACAGCTGCCACAGGG + Intronic
1130300904 15:82679579-82679601 CTGAACAAACAGCTCCAGCTGGG + Intronic
1130829635 15:87585999-87586021 CAGATCAGACAACTGCAGCCTGG - Intergenic
1130836485 15:87654851-87654873 CTGAGCACACAGCTCCTGAAAGG + Intergenic
1131327151 15:91459012-91459034 CAGCCCAGACAGCTGCAGCCAGG + Intergenic
1132372055 15:101306172-101306194 CTGAGGACACCGCTGCAGCAAGG + Intronic
1132665918 16:1081270-1081292 CTGGGCAGACGGCGGGAGCACGG - Intergenic
1132673020 16:1109510-1109532 CTGAGCTGCCCGCTGCAGAATGG + Intergenic
1132774664 16:1586405-1586427 CTGGGCAGAAAGATGCAGCCAGG - Intronic
1132788157 16:1669725-1669747 CTGGGCAGGCAACAGCAGCAGGG - Intronic
1132793926 16:1709124-1709146 CTGAGCAGACAGAATCCGCAGGG + Intronic
1134104624 16:11476922-11476944 CTGAGCTGAGATCTGGAGCAGGG + Exonic
1135322898 16:21508680-21508702 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1135998517 16:27271781-27271803 CAGAGCAGTCAGCTACAGTAGGG - Intronic
1136027903 16:27481760-27481782 CACAGCAGCCAGATGCAGCAGGG - Intronic
1136277274 16:29186437-29186459 CCAAGCAGACATCAGCAGCACGG - Intergenic
1136334382 16:29601865-29601887 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1136922739 16:34345578-34345600 CTGAGCAGACAGGAGTAGGAGGG + Intergenic
1136981834 16:35066228-35066250 CTGAGCAGACAGGAGTAGGAGGG - Intergenic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1139496337 16:67321849-67321871 CTGAGCACGCAGCTTCAGGAGGG + Intronic
1140486650 16:75298950-75298972 TTGATCAGACAGCAGCAGCTGGG + Intronic
1141127942 16:81414501-81414523 CTGAGCTGACAGCTCAGGCAGGG + Intergenic
1142035092 16:87857700-87857722 CTGAGCAGACAGGTGGGGCCAGG - Intronic
1142081653 16:88152481-88152503 CCAAGCAGACATCAGCAGCACGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142157340 16:88538558-88538580 TGGAGCAACCAGCTGCAGCATGG - Intergenic
1203118477 16_KI270728v1_random:1514560-1514582 CGGAGCAGAGAGCTGCAGTCTGG + Intergenic
1142591923 17:1010019-1010041 CTATGCAGTCAGCTGCAGGAAGG - Intronic
1142597387 17:1036216-1036238 CTGAGCAGCCAGCTAGACCAAGG + Intronic
1142699258 17:1649488-1649510 CTGCGCCGACACCTGCAGCTGGG + Exonic
1142978160 17:3657257-3657279 CTGAGCAGGCGGGTGCAGCTGGG + Intronic
1143109554 17:4545545-4545567 CTGAGCAGCGAGCTGCACCAGGG - Intronic
1143792424 17:9308198-9308220 CTGAGCAGACAGGTCCTGCGGGG - Intronic
1146788880 17:35740411-35740433 GTGGGCAGACACCTGCTGCAGGG + Exonic
1146890591 17:36504038-36504060 CAGGGCAGGCACCTGCAGCATGG + Intronic
1148086462 17:44996530-44996552 CAGAGCAGGCAGCTGCTGCCTGG - Intergenic
1148737195 17:49871478-49871500 CTGAGCACACCTCTGCTGCAGGG + Intergenic
1148894273 17:50831008-50831030 CTGAGCAGAGAGGTAAAGCAAGG - Intergenic
1148959306 17:51379902-51379924 CTGAGCAGACTCCAGAAGCATGG + Intergenic
1149531772 17:57401551-57401573 TTGAGGACACAGCTGTAGCAGGG - Intronic
1150318873 17:64193079-64193101 CTGAGCAAAGAGGTGCTGCATGG + Intronic
1151769041 17:76147682-76147704 CTGAGGAGGGAGCAGCAGCAGGG - Intronic
1151999780 17:77637962-77637984 CTGAGCAGAGAGGCGCAGCCAGG - Intergenic
1152489096 17:80616946-80616968 CTGCGCAGTCAGCTGAAGCTTGG - Intronic
1152566804 17:81103899-81103921 CTGGGCAGACATCCGCTGCAGGG - Exonic
1152625373 17:81385721-81385743 TGGTGCAGACAGCTGCAGCTTGG + Intergenic
1152656747 17:81523454-81523476 CTGAGCACAGACCTGCAGCCTGG - Intronic
1154453299 18:14498468-14498490 TTGAACAGACAGCTACAGAATGG - Intergenic
1156376966 18:36523432-36523454 CTCAGCAGACTGCTCCAGAAAGG - Intronic
1156569247 18:38233996-38234018 CTGAGGAGACAGCTGCATTATGG - Intergenic
1156939085 18:42743033-42743055 CAGAGCAGAAATCTGCAGCCTGG - Intergenic
1157782714 18:50454300-50454322 CTGAGCAGAAAGATACAGCAAGG + Intergenic
1157799058 18:50603594-50603616 CTGAGTCCACAGCTGCAGAATGG + Intronic
1159377614 18:67614076-67614098 TCTAGCAGACTGCTGCAGCACGG - Intergenic
1160134355 18:76259920-76259942 CTGCGCAGTCAGCTGCACCGAGG - Exonic
1162040511 19:7968381-7968403 GTGAGGTGACAGCAGCAGCATGG - Intronic
1163360487 19:16842942-16842964 CAGAGCAGACAGCGGCATCAGGG + Intronic
1163415077 19:17181393-17181415 CAGAGAAGCCATCTGCAGCAGGG + Intronic
1163478976 19:17543339-17543361 CTGGTCAGCCAGCTGCAGGAAGG - Exonic
1163618344 19:18342659-18342681 CAGAGCGGACAGGTGCAGGACGG + Intronic
1163647301 19:18496676-18496698 CTGAGTGGACAGCAGCAGCCTGG - Intronic
1163822920 19:19506339-19506361 CTGAGCAGAAAGCTGGAGGGGGG + Exonic
1164424057 19:28124528-28124550 CTGTCCAGACAGATGCAGCAAGG - Intergenic
1164464569 19:28476511-28476533 CTAAGCAGAAAGCAGCTGCAAGG + Intergenic
1164598845 19:29547848-29547870 CAGAGCACATGGCTGCAGCAGGG + Intronic
1165015347 19:32876408-32876430 CAGACCAGACACTTGCAGCATGG + Intergenic
1165853899 19:38868852-38868874 CTGAGGTGACATCTGCAGAAAGG - Intronic
1167672030 19:50859053-50859075 GTGAGCAAACACCTGCCGCAGGG + Intronic
1168615033 19:57830542-57830564 CTGAGCAGAGAGCCTCAGCGTGG - Exonic
925263712 2:2549677-2549699 CAGAGCAGACTGCCGAAGCAGGG - Intergenic
925756841 2:7141403-7141425 CTGAGCATGCAGCTTCAGGAGGG + Intergenic
926418468 2:12674239-12674261 ATAAGCAGGCAGATGCAGCAGGG - Intergenic
927132864 2:20075114-20075136 CTGAGCTGACCTCTGCAGGAGGG - Intergenic
927871795 2:26628726-26628748 CTGAGAAGACAGGAGGAGCAGGG - Intronic
928317589 2:30258072-30258094 TTGAGCAGAGAACTGCAGCCAGG + Exonic
928367835 2:30716277-30716299 CTGAGAAGACGGGTGCAGAATGG - Intergenic
928924402 2:36563347-36563369 CTCAGCAGCCATCAGCAGCAAGG - Intronic
929442957 2:41979810-41979832 CTGAGTAGACAGCAGAGGCATGG + Intergenic
929956786 2:46464295-46464317 CCCAGCAGGCAGGTGCAGCATGG - Intronic
930626892 2:53708343-53708365 CTGAGCAGACACCAACATCATGG + Intronic
930993334 2:57685942-57685964 CTAAGAAGACAGCTGCAGCTTGG - Intergenic
933783684 2:85820534-85820556 CTGAGCACACAGCTTCAAGAGGG + Intergenic
934105989 2:88694841-88694863 CTGAACAGACAGCCGTTGCAGGG + Intronic
934126835 2:88902133-88902155 CTGAACAGACAACTACAGAATGG - Intergenic
935723051 2:105996746-105996768 CTGAGCCGTGAGCTGCAGGAAGG - Intergenic
937078643 2:119125069-119125091 CTGGGCAGAGACATGCAGCAGGG - Intergenic
937381511 2:121381694-121381716 CTGAGCACACAGATCCAGAAAGG - Intronic
939552805 2:143636539-143636561 CTGAGCAGAAATCTCCACCAAGG + Intronic
940011478 2:149059753-149059775 CTGAGCAGACAGCCACAGCCTGG + Intronic
940752286 2:157639476-157639498 CTTAAGGGACAGCTGCAGCAGGG - Intergenic
940905614 2:159166845-159166867 CCGAGCTGAAAGCTGCAGCAGGG - Intronic
940906934 2:159178266-159178288 CTGTGCAGACAGCGGCAACGAGG - Intronic
944306259 2:198183420-198183442 TTGAGTAGACAGCTGTAGAAAGG + Intronic
944318035 2:198304487-198304509 CTAAACAGACAGCTGCAGAGAGG - Intronic
944633985 2:201656777-201656799 TTGAGCAGACATCTGGAGGAAGG + Intronic
945196684 2:207243355-207243377 CTGAGAAGTCAGCTGCAGTCCGG - Intergenic
946401010 2:219468476-219468498 CTGAGCAGGAAGCTGGAGCCTGG - Intronic
946425159 2:219590846-219590868 CTGAGCGCACAGCTTCAGGAGGG + Intergenic
947765158 2:232633333-232633355 CGGAGCTGACAGGGGCAGCAAGG + Exonic
947808351 2:232983511-232983533 CTGAGCAGAGGCCTGCAGGAGGG + Intronic
948617755 2:239212491-239212513 CTGACCAGAGAGCTGAAGCCAGG + Intronic
1168841249 20:911387-911409 CTGAGCAGCCAGCTGCAGGGTGG + Intronic
1169014346 20:2279613-2279635 CTGGGCCTACAGCTGCAGCATGG - Intergenic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1169227414 20:3865286-3865308 CCCAGCAGACAGCCGCAGCTAGG - Intronic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1170442012 20:16388945-16388967 TTGAGCAGGCAGCTGCAGTGCGG + Intronic
1171933655 20:31252640-31252662 GTGAACAGACAGCTACAGAATGG + Intergenic
1172115809 20:32572848-32572870 TGGAGCAGAGAGCTGCAGAAGGG - Intronic
1173920194 20:46738723-46738745 CTGAGCAGAGACCTGCATGAAGG + Intergenic
1175159006 20:56994231-56994253 CTGGGCAAACATCAGCAGCAAGG + Intergenic
1175237271 20:57523886-57523908 CTGAGCATACAGCAGCAAGAAGG - Exonic
1175408812 20:58752683-58752705 CTGAGGAGACGGATGCAGGAGGG - Intergenic
1175751295 20:61499735-61499757 CTGAGCAGACACCAGGAACAGGG + Intronic
1176060945 20:63172771-63172793 CTGGGCTGACAGCTGCTGGATGG - Intergenic
1179919519 21:44499940-44499962 CGGAACAGACAGCGGCAGCCGGG + Intronic
1180119341 21:45736495-45736517 CAGAGATGTCAGCTGCAGCAGGG + Intronic
1181863821 22:25839966-25839988 CTGAGCAGAGAGCTGAAGGAGGG - Intronic
1182258265 22:29053592-29053614 CTCAGCAGACAGCAGCAGCCCGG + Exonic
1182288375 22:29260854-29260876 CCGGGCAGACAGATGCAGCTGGG - Exonic
1182648738 22:31832982-31833004 CTGAGAAGAAAGCTGGAGGAAGG - Intronic
1182676180 22:32041803-32041825 CTCAGCTGTCAGCTGCAGCTTGG - Intergenic
1183694644 22:39414836-39414858 ATGAACAGACACCTGCAGAAGGG - Intronic
1183773875 22:39949804-39949826 CTGAGCAGTCAGAAGCAGCGGGG - Intronic
1184263328 22:43332411-43332433 CAGACCAGCCAGCAGCAGCAAGG + Intronic
1184490258 22:44804225-44804247 CACAGCAGACACCAGCAGCAAGG - Intronic
1185030593 22:48440985-48441007 GTGAGGAGACAGCTGCAGGATGG - Intergenic
1185128931 22:49026613-49026635 CTGAGGAGCCAACTGCAGCTCGG + Intergenic
1185269353 22:49921814-49921836 CTAGGCAGGCAGCTCCAGCAAGG - Intronic
1185343485 22:50301625-50301647 CTGAGCAGCCGGCTGCTGCGGGG - Intronic
950150236 3:10681117-10681139 CTGAGCAGACATTAGCATCATGG + Intronic
950449714 3:13058846-13058868 CCTGGCAGAGAGCTGCAGCAGGG + Intronic
950535813 3:13577507-13577529 CTGAGGTGAGAGCTACAGCAGGG + Intronic
952647397 3:35677832-35677854 GTGAGCAGAAAGCTGAAGTAGGG + Intronic
952820261 3:37480440-37480462 CTGAGGAGAAAGCTGAAGGAAGG - Intronic
954111556 3:48436439-48436461 CTGAGCTGAGAGCCGCAGAAGGG + Intronic
956228923 3:66990830-66990852 CTGAGAAGACAGCTGCATCTTGG + Intergenic
956323531 3:68025747-68025769 CTGAGCAGATACTTGGAGCAGGG - Intronic
957415985 3:79905436-79905458 GTGAGCAGTCAAGTGCAGCATGG - Intergenic
959303822 3:104635136-104635158 CTCAGCACACTGCTGCTGCATGG - Intergenic
961329650 3:126131026-126131048 CTGAGCAGGGACCTGCAGCCAGG + Intronic
961333496 3:126156597-126156619 CGGAGCCCACAGCTGCAGGAGGG - Intronic
961409517 3:126708448-126708470 CTGACCAGAGAACTGCAGCGTGG - Intronic
961680624 3:128597723-128597745 CTGAGAGGACAGCACCAGCAGGG - Intergenic
961743829 3:129050740-129050762 CTGAGCTGACAGCAGCAGGCCGG - Intergenic
962740658 3:138360784-138360806 CTGAGCAGAAAGCTGTGCCAGGG + Intronic
962809539 3:138948985-138949007 CTGCTCAGAAAGCAGCAGCAGGG - Intronic
964661455 3:159124490-159124512 TTGAGCTGACAGCTGAAGAATGG - Intronic
966095137 3:176190894-176190916 GGGAGCAGACAGATGAAGCAGGG + Intergenic
967025629 3:185561479-185561501 CAGAGCAGGCAGCTCCAGCCAGG + Intergenic
967629442 3:191728003-191728025 CTTAGGAGACAGCTGCAGTGAGG + Intergenic
969543279 4:7807423-7807445 CAGAGGAAACAGCTGTAGCACGG - Intronic
970337787 4:15069215-15069237 CTGTGCAGCCAGATGCAACAGGG - Exonic
972344047 4:38177804-38177826 CTCAGAACACAGCTGCGGCATGG + Intergenic
974981881 4:68967119-68967141 CTAGGCAGAAATCTGCAGCAGGG - Intergenic
975265797 4:72365248-72365270 ATGAGCAGACATTTCCAGCATGG + Intronic
976206105 4:82624919-82624941 ATGTGCACACAGCTGCACCATGG - Intergenic
979575977 4:122293348-122293370 CTAGGCAGACAGCTCCACCACGG + Intronic
982652840 4:158108614-158108636 CTGAGCAATCAGCTTCATCACGG - Intergenic
984329057 4:178291812-178291834 CTGAGTAGACAGTTTCAGCCAGG - Intergenic
985099513 4:186444489-186444511 CTGAGTGGACAGCTGTAGGAGGG + Intronic
985360609 4:189171739-189171761 CTGAAGAAACAGCTCCAGCATGG - Intergenic
985524265 5:394186-394208 CTGAGCACAAAGCTGCAGCCTGG - Intronic
985571419 5:647576-647598 CAGACCACACAGCTGCAGCCTGG + Intronic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
986003914 5:3651678-3651700 CTGAGCAGACAGCATCACCAGGG + Intergenic
986347485 5:6848324-6848346 CCGAGCACACAGCTTCAGGAGGG + Intergenic
987033478 5:13996952-13996974 CTGGGCAGAGAACTGCTGCAGGG - Intergenic
988481080 5:31631119-31631141 CAGGGCAGGCAGCCGCAGCATGG + Intergenic
988563851 5:32304751-32304773 CTGATCAAACAGCTGCCACATGG - Intronic
989526945 5:42464584-42464606 CTCAGCACACACCTGCAGAATGG - Intronic
990904865 5:60793019-60793041 TGGAGCAGAGAGCTGGAGCAGGG + Intronic
994593782 5:101806406-101806428 CTAAGATGCCAGCTGCAGCAGGG + Intergenic
995225809 5:109699696-109699718 CTGAGCATGCAGCTTCAGGAGGG + Intronic
997247041 5:132358493-132358515 CAGAGAAGACAACTGCAGGAGGG - Intergenic
998072151 5:139206232-139206254 TTGAGCAGAGAGCTGCAGAAGGG + Intronic
998315267 5:141177642-141177664 CTGAGCAGACAACTGCCCGAAGG - Intergenic
998723163 5:144976784-144976806 CAGAGTAGACAGCAGCAGAATGG - Intergenic
999657428 5:153824587-153824609 CTGAAGAGAGAGCTGCAGCAAGG + Intergenic
1000180190 5:158801734-158801756 GTGTGCAGACAACTGCACCAGGG + Intronic
1000897636 5:166874789-166874811 CTGAGGGGAGAGCAGCAGCAGGG - Intergenic
1001020487 5:168178451-168178473 GTGGGGAGACAGCTGCAGCCAGG + Intronic
1001563719 5:172686413-172686435 CTGAGCATACAGCTGAGGGAAGG - Intronic
1001647409 5:173292418-173292440 CTGAGATGTCAGCTGCAGCCTGG + Intergenic
1001692321 5:173642380-173642402 CCAAGCAGAAAGCTGCAGCTTGG + Intergenic
1002641808 5:180633986-180634008 CTGGGCTGACAGCTGCCGCACGG - Intronic
1002887529 6:1310556-1310578 CTGAGCAGACCCCTCCAGAAAGG + Intergenic
1004005179 6:11631710-11631732 ATGAACAGACAGCTGCTGTACGG + Intergenic
1004170779 6:13294067-13294089 CTGAGCAGAGTGATGTAGCAGGG - Intronic
1005984743 6:30864365-30864387 CTGAGCACACAGCTTCAGGAGGG - Intergenic
1006047125 6:31307822-31307844 CTGCTCAGACACCTGGAGCATGG - Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006592853 6:35170926-35170948 CTGAGCAGAATCCTGCTGCAGGG + Intergenic
1006929425 6:37678738-37678760 CTCAGAAGACAGCTGAAGGAAGG - Intronic
1007197933 6:40079290-40079312 CTGAGCAGACAGAAACAGCACGG + Intergenic
1007622458 6:43223375-43223397 CTGGGCAGAATGCTGCAGGATGG - Exonic
1008649399 6:53547811-53547833 TTCAGCAGACAGCTCCATCAGGG + Intronic
1011129446 6:84038194-84038216 ATGAGCAGCCAGCTGAAGGAAGG + Intronic
1013111703 6:107069769-107069791 CTGGGCACACTGCTGCAGCCAGG + Exonic
1016051423 6:139534394-139534416 CTGAGCAAGCAGATGCAGCTTGG - Intergenic
1018738839 6:166712088-166712110 CTGAGCAGGCTGCACCAGCAGGG - Intronic
1018937606 6:168283910-168283932 CTGAGCAGCAAGCCGGAGCACGG + Intergenic
1019232275 6:170577615-170577637 CTGTGCTGAGAGCTGCAGCTTGG - Exonic
1019749982 7:2723219-2723241 CTGAGCACGCGTCTGCAGCAGGG - Intronic
1019796755 7:3055430-3055452 CTGATCCTGCAGCTGCAGCATGG - Intergenic
1019885364 7:3899728-3899750 CTGGGGAGAGAGATGCAGCATGG - Intronic
1020015420 7:4828825-4828847 ACGAGCGGGCAGCTGCAGCAGGG + Intronic
1020155989 7:5725226-5725248 CTCAGCAGACACCTGTAGCACGG + Intronic
1020812529 7:12864414-12864436 CTGAGTTCACAGCTGCAGAAGGG + Intergenic
1021267515 7:18543377-18543399 CTCAGAAGACAGAAGCAGCAGGG - Intronic
1022383344 7:29881091-29881113 CTGAGCAGAGACCTGCAGGAAGG - Intronic
1022801639 7:33782412-33782434 TTGAGCATACATCTGCAGCTTGG + Intergenic
1023431318 7:40094343-40094365 CTGAGCAAGCAGCTGTAACAGGG - Exonic
1023567073 7:41533839-41533861 CTTAGCAGAAAGCAGCAGTAGGG + Intergenic
1024553936 7:50586866-50586888 GTGAGTATACAGCTACAGCAGGG + Intergenic
1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG + Intronic
1025130929 7:56373936-56373958 CTGAGCCGAGAGATGCAGCCAGG - Intergenic
1028827583 7:95291101-95291123 CTGAACACACAGCAGTAGCAAGG - Exonic
1029408979 7:100397058-100397080 CTGGAAAGAAAGCTGCAGCATGG + Intronic
1030807688 7:113937153-113937175 ACCAGCAGACAGCTCCAGCAGGG - Intronic
1031074356 7:117198715-117198737 CTGAGGAGGCAGGTGCAACAGGG - Intronic
1031230998 7:119106144-119106166 CTGAGAACAAAGCTGCAGCTGGG + Intergenic
1031973229 7:128078447-128078469 TTGAGAAGACAGCAGAAGCAAGG - Intronic
1033040882 7:137917112-137917134 CTGAGAAAACAGCTGCATCTTGG + Intronic
1033157213 7:138967372-138967394 CTGAGCAGAGACCTGAAGGAAGG + Intronic
1033530365 7:142256870-142256892 CAGAGGCAACAGCTGCAGCATGG + Intronic
1035272398 7:157728128-157728150 CTGGGCAGACACATGCAGCCCGG + Intronic
1036585222 8:10117395-10117417 CTGACCAGAGAGCTGGATCAGGG - Intronic
1037325063 8:17680820-17680842 CTGAGCAGACACATGAAGGAAGG + Intronic
1037919203 8:22792312-22792334 CTGAGATGTCACCTGCAGCAGGG - Intronic
1038139968 8:24833816-24833838 CTGAGCAGCCAGCAGCAAAAAGG + Intergenic
1038635753 8:29285850-29285872 CTCAGCTGACAACTGCAGAAGGG + Intergenic
1040089425 8:43381760-43381782 CTGAGCATGCAGCTTCAGGAGGG - Intergenic
1040484502 8:47857243-47857265 AGAAGCAGCCAGCTGCAGCAAGG + Exonic
1040661871 8:49583404-49583426 CTCAGCAGAGAGCTGCAGACAGG + Intergenic
1040701265 8:50068833-50068855 CTGACAAGACAGCAGCAGCAGGG - Intronic
1041724642 8:61006550-61006572 CTGAGCAGACAGATGAAGAAGGG + Intergenic
1044729573 8:95219190-95219212 CTCAGGAGTCAGCTGCAGGAAGG + Intergenic
1044791511 8:95852316-95852338 CTGAGCACCCATCTGCAGCATGG + Intergenic
1046033289 8:108808930-108808952 CTGAGAAGACAGCTTGAGCCTGG + Intergenic
1046285768 8:112091826-112091848 CTCAGGCAACAGCTGCAGCAAGG + Intergenic
1047410258 8:124618710-124618732 ATGAGCAGACAGCTACATTATGG - Intronic
1047527976 8:125649977-125649999 CAGAGCAGAAAGCTGGAGCTGGG - Intergenic
1049015315 8:139915740-139915762 GTTAGCAGACAGCTGTGGCAAGG - Intronic
1049342135 8:142118847-142118869 CTCTGCAGGGAGCTGCAGCAAGG + Intergenic
1049415209 8:142491910-142491932 AGGAGGAGACAGCTGGAGCAAGG + Intronic
1049660937 8:143819449-143819471 CAAAGCAGACAGCTGGAGCCAGG + Intronic
1052340563 9:27360667-27360689 CTCACCAGACAGCTGCTGCTAGG - Intronic
1053344713 9:37369952-37369974 CTGAGCAGCCAAGTGCAGGAAGG - Intergenic
1053459053 9:38254399-38254421 CTGAGCTGAGGGCTGGAGCAGGG + Intergenic
1057080714 9:92172599-92172621 CTGGGCACACTGCTGCAGCCAGG - Intergenic
1057826049 9:98372572-98372594 CTGAGCTGTCTGCTGCAGCCTGG - Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1060228728 9:121811931-121811953 CAGAGCAGCCTGCTGCTGCAAGG + Intergenic
1060729963 9:126030969-126030991 CTCAGCAGGAAGCTGCAGCTGGG - Intergenic
1060808378 9:126593569-126593591 CTGAGCAGACAACTGTGGTATGG - Intergenic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1061754676 9:132804299-132804321 CTGAGGAGTCAGCTCCCGCAGGG - Intronic
1062150433 9:135015663-135015685 CTGAGTAGACAGAGGCAGCTGGG + Intergenic
1062183760 9:135205314-135205336 CGGAGCAGACAGCAGCATAATGG - Intergenic
1062549551 9:137079655-137079677 CTCAGCAGGCAGCTGCTGTAAGG + Intronic
1187774622 X:22742439-22742461 CTGGGCAGACAGCTGCCAAAGGG - Intergenic
1188438474 X:30189864-30189886 CTGTGCAGGCAGCAGCAGAAGGG - Intergenic
1191783704 X:64895018-64895040 CTGGGCACACAGGTGCAGTAAGG + Intergenic
1192089007 X:68132941-68132963 CTGGGCAGAGGGGTGCAGCACGG - Intronic
1194543689 X:95205696-95205718 ATGTGCAGGCAGCTGCAGCTTGG + Intergenic
1195247077 X:103004558-103004580 CCCAGCAGACAGATGGAGCATGG + Intergenic
1197063695 X:122213547-122213569 CTGAGCAGCCATCTCCAGGAAGG + Intergenic
1197234156 X:124040264-124040286 CGGAGCAGTCAGGAGCAGCATGG - Intronic
1199861149 X:151801369-151801391 CAGAGCAGACACCAACAGCAGGG + Intergenic
1200283581 X:154799839-154799861 CAGAGGAAACATCTGCAGCAGGG + Intronic