ID: 1025025369

View in Genome Browser
Species Human (GRCh38)
Location 7:55512340-55512362
Sequence CGCCTGGACCTGGAAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63523
Summary {0: 1, 1: 14, 2: 574, 3: 10758, 4: 52176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025025361_1025025369 8 Left 1025025361 7:55512309-55512331 CCAGCTACCCAGGAGGCTGAGAC 0: 108
1: 7352
2: 102881
3: 209066
4: 233720
Right 1025025369 7:55512340-55512362 CGCCTGGACCTGGAAGGCGGAGG 0: 1
1: 14
2: 574
3: 10758
4: 52176
1025025358_1025025369 17 Left 1025025358 7:55512300-55512322 CCTGTAATCCCAGCTACCCAGGA 0: 1119
1: 56965
2: 146216
3: 233957
4: 202134
Right 1025025369 7:55512340-55512362 CGCCTGGACCTGGAAGGCGGAGG 0: 1
1: 14
2: 574
3: 10758
4: 52176
1025025363_1025025369 1 Left 1025025363 7:55512316-55512338 CCCAGGAGGCTGAGACAGGAGAG 0: 3
1: 117
2: 1969
3: 6409
4: 7413
Right 1025025369 7:55512340-55512362 CGCCTGGACCTGGAAGGCGGAGG 0: 1
1: 14
2: 574
3: 10758
4: 52176
1025025364_1025025369 0 Left 1025025364 7:55512317-55512339 CCAGGAGGCTGAGACAGGAGAGT 0: 6
1: 210
2: 3352
3: 3093
4: 2785
Right 1025025369 7:55512340-55512362 CGCCTGGACCTGGAAGGCGGAGG 0: 1
1: 14
2: 574
3: 10758
4: 52176
1025025360_1025025369 9 Left 1025025360 7:55512308-55512330 CCCAGCTACCCAGGAGGCTGAGA 0: 151
1: 9654
2: 117702
3: 221008
4: 241512
Right 1025025369 7:55512340-55512362 CGCCTGGACCTGGAAGGCGGAGG 0: 1
1: 14
2: 574
3: 10758
4: 52176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025025369 Original CRISPR CGCCTGGACCTGGAAGGCGG AGG Intronic
Too many off-targets to display for this crispr