ID: 1025026345

View in Genome Browser
Species Human (GRCh38)
Location 7:55519420-55519442
Sequence AAGCTGATCTATAAAACAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025026342_1025026345 0 Left 1025026342 7:55519397-55519419 CCTCTGACGCCCAAGCTCTGACA 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1025026345 7:55519420-55519442 AAGCTGATCTATAAAACAATTGG 0: 1
1: 0
2: 0
3: 19
4: 276
1025026343_1025026345 -9 Left 1025026343 7:55519406-55519428 CCCAAGCTCTGACAAAGCTGATC 0: 1
1: 0
2: 1
3: 14
4: 136
Right 1025026345 7:55519420-55519442 AAGCTGATCTATAAAACAATTGG 0: 1
1: 0
2: 0
3: 19
4: 276
1025026344_1025026345 -10 Left 1025026344 7:55519407-55519429 CCAAGCTCTGACAAAGCTGATCT 0: 1
1: 0
2: 2
3: 10
4: 176
Right 1025026345 7:55519420-55519442 AAGCTGATCTATAAAACAATTGG 0: 1
1: 0
2: 0
3: 19
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025026345 Original CRISPR AAGCTGATCTATAAAACAAT TGG Intronic
900280899 1:1867906-1867928 ATACTGATCTATAAATTAATGGG - Intronic
903782406 1:25829489-25829511 AAGCTGAAAGAGAAAACAATAGG - Exonic
904153904 1:28466266-28466288 AAGCTAATCTATAAATTAATTGG + Intronic
909939079 1:81589808-81589830 TAGTTGATCAAGAAAACAATGGG + Intronic
910461810 1:87455402-87455424 ATGCAAATGTATAAAACAATGGG - Intergenic
913219149 1:116645519-116645541 AAGCAAATCTTTAAAACACTAGG + Intronic
916160843 1:161912255-161912277 AATCTGTTATATATAACAATTGG - Intronic
917348512 1:174053890-174053912 ATACTGATCTATATAACAATAGG + Intergenic
917652468 1:177092074-177092096 CAGCTGATGCAGAAAACAATTGG - Intronic
918388402 1:184034437-184034459 AATCTGATTTATAAATCATTTGG + Intronic
1063403136 10:5767286-5767308 AAGATGATCTGTAGAACAAAGGG - Intronic
1065714254 10:28549418-28549440 AAGATTATCTATAGAACATTAGG - Intronic
1065901976 10:30216152-30216174 AACATGATTTATCAAACAATAGG + Intergenic
1068144777 10:53054211-53054233 AAGTTGATCTCTTAATCAATTGG - Intergenic
1068851312 10:61744747-61744769 AAGCTGATTTATGATACAGTAGG - Intronic
1070933873 10:80278792-80278814 ACGCTGAGCTATAACACCATGGG + Intronic
1072090046 10:92118535-92118557 AGGATATTCTATAAAACAATGGG + Intronic
1072392570 10:95002421-95002443 AATCTGCACTATAAAACAAATGG + Intergenic
1074743984 10:116513147-116513169 AGGAAGAACTATAAAACAATTGG + Intergenic
1074795951 10:116943992-116944014 AAGCTGATCTCTAACATAAGAGG + Intronic
1075592794 10:123704457-123704479 AAACTGATCTATAACCCAAGGGG - Intergenic
1079722030 11:23827272-23827294 AAGCAGAACAATAAGACAATTGG + Intergenic
1079919793 11:26418761-26418783 AAGCTTATATATAAAATACTTGG + Intronic
1080092924 11:28370136-28370158 ATACTGATCTATCAAACAGTAGG + Intergenic
1080272416 11:30465191-30465213 AGGCTGTAATATAAAACAATTGG + Intronic
1080552616 11:33386802-33386824 GTGCTGGTCTATAAAATAATAGG + Intergenic
1081474988 11:43420697-43420719 AGGCTGAAGTATAAAACCATTGG - Intronic
1083037021 11:59648027-59648049 AACCTGTACTATAAAACAGTAGG + Intronic
1084869345 11:72086452-72086474 AAGCTGTTCTTTCTAACAATTGG - Intronic
1085104460 11:73830227-73830249 AATCTGATTTATAAAACCACAGG - Intronic
1089923731 11:122235393-122235415 AAGGGCATCTATAATACAATGGG + Intergenic
1091041102 11:132282699-132282721 AAGATGATTTAGAAAACATTAGG + Intronic
1091411537 12:243501-243523 CAGCTGATCTATCAGAGAATGGG - Intronic
1093888429 12:24490164-24490186 AAGCTGAGTTATAGAACAAATGG - Intergenic
1094766430 12:33600657-33600679 AAGTTGATTTATGAAAAAATTGG - Intergenic
1095061589 12:37699552-37699574 AAACTGCTCTATAAAAACATAGG + Intergenic
1095066049 12:37776741-37776763 AAACTGATCTATCAAACGAATGG - Intergenic
1095313844 12:40734166-40734188 ATTCAGATCTACAAAACAATTGG + Intronic
1096954468 12:55511524-55511546 ATGCTCATCTATCAAACCATGGG + Intergenic
1097766235 12:63530386-63530408 AAGCTAAGCTATAAATCAAGGGG + Intergenic
1097782669 12:63726227-63726249 AAGCTAAGCTATAAATCAAGGGG + Intergenic
1097830535 12:64220184-64220206 AAACTGACCTATACAACATTTGG - Intronic
1098903618 12:76138894-76138916 AAACTGAACTATAAAATAAATGG + Intergenic
1099406141 12:82265703-82265725 AAGCTTATATAAAAAAAAATTGG - Intronic
1101185675 12:102276012-102276034 AAAATGAACTATAAAAGAATAGG + Intergenic
1103868650 12:124074791-124074813 AAGCTCATCTATAAAACCAATGG - Intronic
1105165645 13:17506202-17506224 AAGCTGCTCTATAAAAAGAAAGG - Intergenic
1106159613 13:27189056-27189078 AAGCCCATTTATAAAGCAATTGG + Intergenic
1107083642 13:36402498-36402520 AATCTGCACTATAAACCAATTGG - Intergenic
1107158852 13:37201688-37201710 AATCCTATCTATAGAACAATGGG + Intergenic
1108696765 13:52908947-52908969 AAGCTGGTATTTAAAATAATAGG + Intergenic
1109617416 13:64853428-64853450 TAGCTGAACCATAAAACAATGGG - Intergenic
1109724409 13:66320506-66320528 AAGCTGTTGTCTAGAACAATTGG + Intronic
1109770764 13:66969364-66969386 AAGCTGCTGAATATAACAATGGG - Intronic
1109770766 13:66969391-66969413 AAGCTGCTGAATATAACAATGGG - Intronic
1113356542 13:109586387-109586409 AAGCTGATATATAAAAGCAGTGG + Intergenic
1114358566 14:21943076-21943098 AAACTTATCTAGAAGACAATTGG - Intergenic
1115849806 14:37582469-37582491 ATGCTGCTCTATAAGACAAAGGG + Intergenic
1116232197 14:42231413-42231435 AAGCTGATGTATAAAATCAAAGG - Intergenic
1116652039 14:47605608-47605630 AAGCTTATCTATAACACTATGGG - Intronic
1116766230 14:49073527-49073549 AATCTGCTCTATAGAACAAATGG + Intergenic
1116890421 14:50262517-50262539 AAGCTGTTAGATAAAAAAATGGG - Intronic
1117177129 14:53156228-53156250 AAGATGATCTAGAAAACAAAAGG - Intergenic
1118840820 14:69509208-69509230 AAGCTCAACAATAAAAAAATGGG - Intronic
1118944815 14:70374796-70374818 AAACTTATTTATAAAACCATTGG - Intronic
1120221060 14:81734131-81734153 AAACTGATATATAGACCAATGGG - Intergenic
1123229556 15:17088867-17088889 AAACTGCTCTATCAAAAAATAGG - Intergenic
1123232951 15:17148540-17148562 AAACTGCTCTATCAAAAAATAGG - Intergenic
1123339499 15:18980170-18980192 AAGCTGCTCTGTAAAAAAAAAGG - Intergenic
1125963560 15:43853508-43853530 AAGCTTGACTTTAAAACAATAGG + Intronic
1130084810 15:80768832-80768854 AAGCAAGTTTATAAAACAATTGG - Intergenic
1133406043 16:5525329-5525351 GAGCTGTTGTATAAAACAAGAGG - Intergenic
1135200568 16:20434228-20434250 AAGCAGAATTATAAAACTATTGG - Intronic
1135389557 16:22078701-22078723 AATCTAATTTAAAAAACAATGGG - Intronic
1135832741 16:25790756-25790778 AAGAACATCTATAAACCAATAGG - Intronic
1138828928 16:60355438-60355460 AAGCTGATGGACAAAACAAGTGG - Intergenic
1139541582 16:67621820-67621842 AAACTCATCTATAAATTAATGGG + Intronic
1140982919 16:80127792-80127814 CAGGTGATATATAAAGCAATGGG + Intergenic
1144588639 17:16504883-16504905 AAGCTTATCAATAAAAGCATTGG - Intergenic
1145556109 17:24776014-24776036 AAGCTGAACTATCAAAGAAAAGG - Intergenic
1145692181 17:26753667-26753689 AAGCTGATTTTTAAAATACTGGG + Intergenic
1146739223 17:35267201-35267223 AAAATGATTAATAAAACAATTGG + Exonic
1148803927 17:50254274-50254296 AAGCTGATTTAAAAAAAAAAAGG + Intergenic
1149970144 17:61209841-61209863 AAGCTGTTCTATTAAACATAGGG - Intronic
1153828364 18:8897900-8897922 AAGCTGATCTATAATAATTTGGG - Intergenic
1154538252 18:15495652-15495674 AAGCTGATCTATAAAGAGAAAGG - Intergenic
1154542361 18:15555487-15555509 AAGCTGATCTATAAAGAGAAAGG - Intergenic
1154555519 18:15747740-15747762 AAGCTGATCTATAAAGAGAAAGG - Intergenic
1154906066 18:20573365-20573387 AAACTGATCTATAAAGAGATAGG + Intergenic
1154906300 18:20576933-20576955 AAGCTGATCTATAAAGAGAAAGG + Intergenic
1154906526 18:20580334-20580356 AAGCTGATCTATAAAGAGAAAGG + Intergenic
1154910396 18:20641183-20641205 AAACTGATCTATAAAGAGATAGG - Intergenic
1155589782 18:27413565-27413587 ATGCTGACCTAAAGAACAATGGG + Intergenic
1155816377 18:30316368-30316390 GAGCTTATCTTTAAATCAATTGG - Intergenic
1156152474 18:34258839-34258861 AATCTGATATGTAAAACACTTGG - Intergenic
1156708742 18:39915656-39915678 ACTCTGATCTATAAAACAGCAGG + Intergenic
1157142692 18:45126522-45126544 AAACTGCTTTATAAAACCATCGG - Intergenic
1158831321 18:61282854-61282876 AAGATGAAAAATAAAACAATAGG + Intergenic
1159334735 18:67047684-67047706 AATGTAATCTATAAGACAATGGG - Intergenic
1159855100 18:73577407-73577429 AAGCTGATAGAGAAAACAAAAGG - Intergenic
1160263572 18:77318540-77318562 AAGCTGCTCTATTAAACTAATGG - Intergenic
1166407984 19:42536322-42536344 AATCTGAACTATAGAACAAATGG - Intronic
1168637670 19:58009206-58009228 AAGTTGATTAAAAAAACAATAGG - Exonic
926662675 2:15485337-15485359 AATCTGATCTTTCAAATAATAGG + Intronic
926879099 2:17521295-17521317 ATGCTGAGCTATAACACCATAGG + Intergenic
928190231 2:29158610-29158632 ATGCAAATCTATAAAACAAGTGG - Intronic
928731408 2:34237298-34237320 AAGTTAATCCCTAAAACAATGGG + Intergenic
928857709 2:35819230-35819252 CAGCTGGGCTATAAAACACTTGG - Intergenic
930479507 2:51928140-51928162 AATCATATCTTTAAAACAATTGG - Intergenic
930491670 2:52081483-52081505 TTGCTGATCTATAACAAAATAGG - Intergenic
933266458 2:80185997-80186019 AAGCTAATCTCCACAACAATTGG - Intronic
933429902 2:82162860-82162882 CTGCTGATCTATCAAACAGTAGG + Intergenic
935240019 2:101170313-101170335 ATGCTGATCCCCAAAACAATGGG + Intronic
936831877 2:116656329-116656351 AAGCTAATCCCCAAAACAATGGG - Intergenic
936852573 2:116918474-116918496 AAACTTATCTATGAAAGAATTGG + Intergenic
937491913 2:122378509-122378531 TAGCCGATCTATAAAACATATGG + Intergenic
937737419 2:125309195-125309217 AAGCTGAATTTTAAAACAATGGG + Intergenic
938553309 2:132400516-132400538 AAGCTGCTTTAGAAAATAATTGG - Intergenic
939525196 2:143284489-143284511 CAGCTGAGCTAAAAGACAATTGG + Intronic
939802463 2:146727103-146727125 AATCTGATATATAAAGAAATAGG + Intergenic
941302773 2:163824851-163824873 AATCTGCACTATAAAACAAATGG - Intergenic
941364644 2:164595337-164595359 AAGCAGATATAAAAAACTATTGG + Intronic
941658308 2:168168233-168168255 AAGCTGAGAAATAAAACAAAAGG + Intronic
941891018 2:170582044-170582066 AAGGTAATTTATAAATCAATAGG - Intronic
943045018 2:182850292-182850314 ATACTGATCTATCAAACACTAGG + Intronic
943577396 2:189646592-189646614 AGGCTTATATATAATACAATAGG + Intergenic
944204256 2:197140913-197140935 AAGCTGCTTTAAAAATCAATAGG + Intronic
946220206 2:218219119-218219141 AAGCTGATCTACAAGATAAATGG + Intronic
947513345 2:230779506-230779528 ACCATGATCTATAAAACAGTTGG + Intronic
948871983 2:240805288-240805310 AAGCAGAACTGAAAAACAATGGG + Intronic
1169992375 20:11517746-11517768 AAGCTCATCTATAAAACCCCAGG - Intergenic
1171738857 20:28834331-28834353 AAGCTGCTCTATCAAAAGATAGG - Intergenic
1171744746 20:28958440-28958462 AAACTGCTCTATAAAAAGATAGG - Intergenic
1171761688 20:29206640-29206662 AAACTGCTCTATAAAAAGATAGG - Intergenic
1171807612 20:29696488-29696510 AAGCTGCTCTATAAAAAGAAAGG - Intergenic
1173531791 20:43775328-43775350 AAGATGACCAATAAAACCATGGG + Intergenic
1176318040 21:5269578-5269600 AAACTGCTCTATAAAAAGATAGG + Intergenic
1176475903 21:7206356-7206378 AAACTGCTCTATAAAAAGATAGG + Intergenic
1177645410 21:23894316-23894338 AGGCTGATCTATAGAAAAAGTGG - Intergenic
1179019079 21:37621932-37621954 AAGTTGATTTATAAATGAATGGG + Exonic
1180820441 22:18823575-18823597 AAGCAAATCTTTAAAACACTAGG + Intergenic
1181206665 22:21258047-21258069 AAGCAAATCTTTAAAACACTAGG + Intergenic
1182213535 22:28696760-28696782 CACCTGATCTCTAAAATAATTGG + Intronic
1183191897 22:36326922-36326944 AAACTGATTTTTAAAACACTTGG - Intronic
1203220259 22_KI270731v1_random:37376-37398 AAGCAAATCTTTAAAACACTAGG - Intergenic
1203270567 22_KI270734v1_random:49450-49472 AAGCAAATCTTTAAAACACTAGG + Intergenic
950654526 3:14428305-14428327 AAGATGATCTGTAAAGCACTCGG + Intronic
951796737 3:26547458-26547480 AAGCTGAAGTACAAAACAAGAGG - Intergenic
953733343 3:45468935-45468957 AAGCTATTCTATAAAGCACTTGG + Intronic
955374913 3:58386798-58386820 ATCCTGACCTATAAAACAAGAGG + Intronic
956130349 3:66047399-66047421 AAGCTGATCCAGCAAACACTAGG + Intergenic
956774805 3:72556141-72556163 AAGCAGAAATATAAAACAATAGG + Intergenic
958135009 3:89477481-89477503 AAGGTGTTCAAGAAAACAATAGG - Intronic
958169191 3:89917157-89917179 AATCAGTTCTATAAGACAATTGG + Intergenic
958206916 3:90412060-90412082 AAACTGATCTATAAAAAGACAGG + Intergenic
958214134 3:90539399-90539421 AAACTGCTCTATAAAAACATTGG + Intergenic
958539704 3:95455230-95455252 ATGCTGATCTTTAAAGCAGTTGG + Intergenic
960243538 3:115373901-115373923 AAAATGCTCTATAAAACAAATGG + Intergenic
962592402 3:136904718-136904740 AACCTGTTCAATAAAATAATAGG - Intronic
963340857 3:144031345-144031367 AAGCTGTTCTACAACACAATTGG - Intronic
963408056 3:144893497-144893519 AAGCTGGCCTAAAAAGCAATGGG + Intergenic
963428695 3:145167504-145167526 TAGCTGATTTAAAAAAAAATAGG + Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964403902 3:156328789-156328811 AAATTGATCTATAATTCAATAGG + Intronic
964998996 3:162927602-162927624 CTGCTGATCTATAAAACACTAGG - Intergenic
965053962 3:163690082-163690104 AAGATAATCAATATAACAATGGG + Intergenic
965459627 3:168945964-168945986 AAGTTGTTCTATAAAAGAATAGG + Intergenic
965706511 3:171513407-171513429 AAGTTGATCTATATGACAACTGG - Intergenic
967371803 3:188755104-188755126 ATGCTGATATATCATACAATTGG + Intronic
967401607 3:189068938-189068960 AAGCTAAACGTTAAAACAATTGG + Intronic
967501542 3:190203755-190203777 ATGTTAATCTCTAAAACAATGGG + Intergenic
967505078 3:190244709-190244731 AAGGTGAACTATAAAACACAAGG - Intergenic
968031784 3:195505273-195505295 AAGCTGCTCTGTATAACAGTGGG + Intergenic
970050639 4:11911017-11911039 CAGCTGATTTATAAAGCAGTTGG + Intergenic
971297225 4:25406765-25406787 AAGCTGCTCAATAAAAGAAATGG - Intronic
971374078 4:26042163-26042185 AAGCTGTTTTATAAAAGTATCGG - Intergenic
973838226 4:54832843-54832865 AATCAGATCCATAAAACTATTGG + Intergenic
974066581 4:57083484-57083506 AAGTTGATCGATAAAGCAACAGG - Intronic
974273578 4:59685521-59685543 AAGGTGATATATAAAAAAACAGG + Intergenic
974524431 4:63029607-63029629 GGGCTGACCCATAAAACAATGGG - Intergenic
975028403 4:69581474-69581496 AAACTGATCTATACAAGAAAAGG + Intergenic
975858557 4:78651153-78651175 AAGAGGATCTAGAAAACAATTGG - Intergenic
979926397 4:126570393-126570415 GAGATGATTGATAAAACAATGGG + Intergenic
979946676 4:126841299-126841321 GAGCTAATCTATAAAATAACTGG - Intergenic
980320094 4:131260447-131260469 TTGCAGATCTAGAAAACAATAGG + Intergenic
980386977 4:132099782-132099804 AATATGATTTTTAAAACAATTGG + Intergenic
980538388 4:134160158-134160180 ATGCTGATCTGGAAAACAATGGG + Intergenic
981739643 4:147988672-147988694 AACATGATCCATAAAAAAATGGG + Intronic
981972943 4:150688097-150688119 AAACAGATATATAAAACAAATGG + Intronic
982445037 4:155480781-155480803 TAAATAATCTATAAAACAATAGG - Intergenic
982501638 4:156164454-156164476 GAGCTAAACAATAAAACAATAGG + Intergenic
982907490 4:161093329-161093351 AAGCTGACCTATAATTAAATAGG + Intergenic
982964352 4:161884621-161884643 AAGGTAATTTAAAAAACAATAGG - Intronic
983680065 4:170343154-170343176 ATGCTGAGCTCTAAAACCATAGG - Intergenic
986006136 5:3670505-3670527 AAGCTAATCAATAAAGGAATTGG - Intergenic
988255647 5:28817241-28817263 AAACTCATCTATAAAACCTTTGG - Intergenic
988950270 5:36250292-36250314 AAGCAAATCTATTAAACAAATGG - Intronic
989839021 5:46036582-46036604 AAGCTGCTCAATCAAACAAAAGG - Intergenic
989859873 5:46357481-46357503 AAGCTGATCTATCAAAAAGAAGG + Intergenic
989863501 5:46415644-46415666 AAGCTGATCTATCAAAAGAAAGG - Intergenic
990083669 5:51948373-51948395 AAGATGAACTATAAAAGTATTGG + Intergenic
990111918 5:52336884-52336906 AACCTGACCAAAAAAACAATGGG - Intergenic
991336869 5:65558590-65558612 AAACAGATATATAAAAAAATGGG + Intronic
993635999 5:90344268-90344290 AAGTTTATCTTAAAAACAATGGG + Intergenic
993673440 5:90789657-90789679 AAAATAATTTATAAAACAATAGG - Intronic
997338010 5:133121539-133121561 AAAATGATTTATAAAACAAAAGG + Intergenic
998562929 5:143188248-143188270 GAGCTGACCTAGAACACAATAGG + Intronic
998810025 5:145957075-145957097 CAGCTGTTATATAAAAGAATTGG - Intronic
999546934 5:152639747-152639769 AAGATAATGTATAAAACACTTGG + Intergenic
1002558182 5:180060734-180060756 AAGGGGATCTATAAAGCAAAAGG + Intronic
1005664765 6:28041223-28041245 AAGCTGAATTGTAAAACCATTGG + Intergenic
1008324107 6:50155714-50155736 ATGTTGATATATAAAACAGTAGG - Intergenic
1009623281 6:66102927-66102949 AAGCGTAGATATAAAACAATAGG + Intergenic
1010264099 6:73848564-73848586 AAGCTGTACTAGAAAACAAATGG - Intergenic
1011151948 6:84284057-84284079 AAGCTCATCTCTAAAAGAATAGG - Intergenic
1011222533 6:85070684-85070706 AAGCAGATATATAGACCAATGGG + Intergenic
1011229731 6:85146948-85146970 AAACAGATATATAGAACAATGGG - Intergenic
1011780200 6:90780099-90780121 TACCTGATTTATAAAAAAATGGG - Intergenic
1012201392 6:96410842-96410864 AATATGAAATATAAAACAATAGG + Intergenic
1012488534 6:99750578-99750600 AAGCTGTTCTCTTAAGCAATGGG - Intergenic
1012940762 6:105412671-105412693 CATCTGAACTATAAAACAAATGG + Intergenic
1013292916 6:108734019-108734041 AAGCACTGCTATAAAACAATGGG - Intergenic
1013799665 6:113928217-113928239 ACACTGATCTATCAAACACTAGG + Intergenic
1015633423 6:135253318-135253340 AAGCTGCTCTGCAAAACAAAGGG - Intergenic
1015716737 6:136200642-136200664 ATGCTGTTCTATAACACTATAGG - Intergenic
1015757752 6:136625245-136625267 CAGCTGATATATAAACAAATGGG + Intronic
1016316942 6:142800396-142800418 ATGCTTCTCTATGAAACAATGGG + Intronic
1016643236 6:146375408-146375430 AATCTGCACTATAAAACAAATGG - Intronic
1016727764 6:147395117-147395139 AATCTGCTCTATAAAAGAACAGG - Intergenic
1018490870 6:164291709-164291731 AAGCTTATGCAGAAAACAATGGG + Intergenic
1020511657 7:9064322-9064344 AATTTTATTTATAAAACAATTGG - Intergenic
1020573305 7:9893504-9893526 AATCTGCGCTATAAAACAAACGG + Intergenic
1020759057 7:12245335-12245357 AAATTGATCTCTAAAACAAACGG - Intergenic
1020824752 7:13012805-13012827 AAGCTGATCTTTTCAACAAGTGG - Intergenic
1022553838 7:31271591-31271613 AAAATGATGAATAAAACAATTGG + Intergenic
1023324134 7:39034168-39034190 AAGCTCTTCTGTGAAACAATAGG - Intronic
1024424969 7:49214944-49214966 AACCTGATATTTAAAAAAATAGG - Intergenic
1024850021 7:53702139-53702161 AAGTTCATCTTTAAAACAAAGGG + Intergenic
1024991405 7:55237314-55237336 AAGCAGATTAATAAAGCAATGGG - Intronic
1025026345 7:55519420-55519442 AAGCTGATCTATAAAACAATTGG + Intronic
1025309272 7:57908391-57908413 AAACTGCTCTATCAAAAAATAGG + Intergenic
1026175391 7:67992025-67992047 AAGCAGATCCCTAAAACAAACGG + Intergenic
1027843936 7:83348090-83348112 CAGCTGATCTAGATAAGAATGGG - Intergenic
1029596629 7:101541110-101541132 TAGCTGAGCTGTAAGACAATAGG - Intronic
1031566269 7:123300787-123300809 AATCTGAACTATAAACCAAATGG + Intergenic
1033535323 7:142307006-142307028 TTCCTGATCTATGAAACAATGGG - Intergenic
1033846831 7:145443927-145443949 AAGTTGATCTATAATACAGAGGG + Intergenic
1034380218 7:150685722-150685744 GAGCTGAGCTATAAGACAACAGG + Exonic
1034951793 7:155302974-155302996 AAGCTTATATTTAAAAAAATAGG + Intronic
1038398374 8:27264041-27264063 AAGCTAAACTAAAAAACAGTAGG + Intergenic
1041593159 8:59615231-59615253 ATGCTTATCTTTAAAATAATTGG + Intergenic
1041709715 8:60883036-60883058 AAGATGATCTGAAAAAAAATGGG - Intergenic
1042819514 8:72915222-72915244 TGACTGATCTTTAAAACAATAGG + Intronic
1042895873 8:73667283-73667305 AAGCTGAGGGATAAAATAATTGG - Intronic
1044434549 8:92146702-92146724 AAGGTGATCTAAAAAAAAAAAGG - Intergenic
1049490078 8:142893503-142893525 AATCTGAACTATAAACCAAATGG - Intronic
1049851632 8:144835123-144835145 GAGCTAATCTGTAAAACCATCGG + Intronic
1050452081 9:5792672-5792694 AAGTTGACCTTTTAAACAATAGG - Intronic
1050800842 9:9611521-9611543 AATCTGATGTATAAAACATTTGG + Intronic
1051027568 9:12631237-12631259 AAGATGCTGTATAAAACAATTGG + Intergenic
1051032428 9:12697765-12697787 TCTCTGATCTAAAAAACAATGGG + Intronic
1052153620 9:25153066-25153088 AAGTTGATCTAAAAATCAATCGG - Intergenic
1054704002 9:68444470-68444492 AAGCTGGTCTCAAAAATAATAGG + Intronic
1054996899 9:71401704-71401726 AAGCTGAGGTATTAAAGAATTGG + Intronic
1055824824 9:80311439-80311461 TAGATGATTTATAAAAGAATAGG - Intergenic
1056059215 9:82865526-82865548 CAAAGGATCTATAAAACAATCGG + Intergenic
1056184865 9:84124614-84124636 AAGCTGACCACTAAAACAAAAGG - Intergenic
1058070147 9:100593657-100593679 AAGATGATTTAAAAAAAAATAGG - Intergenic
1059782302 9:117542769-117542791 ATGCTGAGCTATTAAAAAATAGG - Intergenic
1059817852 9:117938081-117938103 AAACTGATCTCTCTAACAATTGG - Intergenic
1061292981 9:129662874-129662896 TTGCTGATCTGTAAAACAAAAGG + Intergenic
1203384906 Un_KI270438v1:21635-21657 AAACTGATCTATCAAAAGATAGG - Intergenic
1203357087 Un_KI270442v1:164994-165016 AAACTGCTCTATAAAAAGATTGG - Intergenic
1203374795 Un_KI270442v1:359556-359578 AAGCTGCTCTATCAAAAGATAGG - Intergenic
1203403895 Un_KI270511v1:2236-2258 AAACTGATCAATAAAAAGATAGG + Intergenic
1203411335 Un_KI270579v1:9043-9065 AAACTGCTCTATAAAAAGATAGG + Intergenic
1186751448 X:12625709-12625731 CTGCTGATCTATAAAACACTAGG - Intronic
1187782213 X:22839590-22839612 AAGCTGATAAGTAAAACAAGTGG - Intergenic
1188046058 X:25426956-25426978 AATCTGCACTATAAAACAAATGG - Intergenic
1188421670 X:29997096-29997118 AAGCTATTTCATAAAACAATTGG - Intergenic
1188902906 X:35756993-35757015 CTACTGATCTATAAAACACTAGG + Intergenic
1189972853 X:46435457-46435479 AAGCTGAGAAATATAACAATAGG + Intergenic
1190384284 X:49869473-49869495 AAGCTGATTTAAAAAAAAATAGG + Intergenic
1191039801 X:56067319-56067341 AATCTGATATGTAAAAAAATAGG - Intergenic
1193019727 X:76778924-76778946 AAGCAGGTCTACCAAACAATTGG - Intergenic
1193504536 X:82325946-82325968 AACCTGAACTATAGAACAAATGG - Intergenic
1194926666 X:99833922-99833944 AATCTGCACTATAAAACAAATGG + Intergenic
1196361273 X:114863049-114863071 AATGTGATATATACAACAATTGG - Intronic
1197226130 X:123958777-123958799 AAGATGGTCTATAAAAGAAATGG + Intergenic
1197458223 X:126704708-126704730 AATCTGCACTATATAACAATTGG + Intergenic
1198635363 X:138692790-138692812 AAGCTAAACAATAAAATAATTGG - Intronic
1198766512 X:140085369-140085391 AAGCTGACCAAGAAAGCAATAGG - Intergenic
1198925562 X:141788144-141788166 AAGCTGACTTAAAAAACCATGGG - Intergenic
1199364309 X:146961127-146961149 AAGTTGCTCTATAAGACACTTGG + Intergenic
1199915763 X:152338644-152338666 AACCTGAACTATAAAACTGTTGG - Intronic
1201080011 Y:10233293-10233315 AAGCTGCTCTATCAAAAGATAGG + Intergenic