ID: 1025028533

View in Genome Browser
Species Human (GRCh38)
Location 7:55537214-55537236
Sequence AAATATGTGTGTTCAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025028533_1025028539 14 Left 1025028533 7:55537214-55537236 CCTTCAGCTGAACACACATATTT 0: 1
1: 0
2: 1
3: 17
4: 267
Right 1025028539 7:55537251-55537273 CCACAGCGTGCAGCAACATCTGG No data
1025028533_1025028541 27 Left 1025028533 7:55537214-55537236 CCTTCAGCTGAACACACATATTT 0: 1
1: 0
2: 1
3: 17
4: 267
Right 1025028541 7:55537264-55537286 CAACATCTGGGAAGCCAAGCAGG 0: 1
1: 0
2: 1
3: 47
4: 418
1025028533_1025028540 15 Left 1025028533 7:55537214-55537236 CCTTCAGCTGAACACACATATTT 0: 1
1: 0
2: 1
3: 17
4: 267
Right 1025028540 7:55537252-55537274 CACAGCGTGCAGCAACATCTGGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025028533 Original CRISPR AAATATGTGTGTTCAGCTGA AGG (reversed) Intronic
901698578 1:11030226-11030248 AAATATGTGTGTGAGGCTGATGG - Exonic
902305894 1:15538990-15539012 TAATGTGTATGTGCAGCTGAGGG + Intronic
904129272 1:28263471-28263493 AAATATCTGAATTCAGCTGGGGG + Intronic
906053267 1:42892647-42892669 TAATATGTCTTTACAGCTGAAGG + Intergenic
906996478 1:50800283-50800305 AAATCTGTGGGTTCAGCTACTGG - Intronic
908719003 1:67102960-67102982 AAACATATGTTTTCACCTGATGG - Intronic
911196821 1:95003176-95003198 AAATATGTTTATTCAGCCTATGG - Intronic
912131131 1:106602064-106602086 AAATAATTGTGTTCAACTGTTGG + Intergenic
913959611 1:143328204-143328226 AAATGTGTGTGTTTTGCTGTTGG + Intergenic
914053970 1:144153777-144153799 AAATGTGTGTGTTTTGCTGTTGG + Intergenic
914125176 1:144812588-144812610 AAATGTGTGTGTTTTGCTGTTGG - Intergenic
915535251 1:156531439-156531461 GGACATGTGTGCTCAGCTGAAGG - Intronic
916271283 1:162944959-162944981 AAATATGTGTCTGTAGCTGCAGG - Intergenic
917766215 1:178220172-178220194 AAAGAGGTCTGTTCAGCTCAAGG - Intronic
919380609 1:196856156-196856178 AAATGTGTGTTTTGAGCTGAGGG - Intronic
922048639 1:221969725-221969747 CAAAATGTGAGTACAGCTGAAGG - Intergenic
922755832 1:228096535-228096557 CGATATTTGTGTTCTGCTGAGGG + Intronic
923665646 1:235996272-235996294 CAAAGTGTGTGTTCAGCTGTTGG - Intronic
923897720 1:238291545-238291567 AAATATGTGTGACGATCTGAAGG + Intergenic
924833142 1:247619269-247619291 AAATATGTATATTCAGTTGATGG + Intergenic
1065550805 10:26866959-26866981 AAATATGTGGGTGCAGGTGAGGG - Intergenic
1069184313 10:65403912-65403934 AAATATGTGAGTTAATATGATGG + Intergenic
1071100255 10:82028637-82028659 AAAGATGTGTGCTGATCTGAGGG - Intronic
1071303577 10:84276668-84276690 AAGTATGTGTATTCTGCTGCTGG - Intergenic
1071886623 10:89958263-89958285 TAAAATGTGTGGTCAGCTGAAGG - Intergenic
1072813432 10:98481731-98481753 AAATATTTGTGGGCAGCTGTTGG + Intronic
1073033145 10:100544063-100544085 AAAAGTGTGTGTTCAACTCATGG + Intronic
1073537235 10:104288687-104288709 AAATTTGTCTGTTCAGTTCAGGG + Intronic
1074478278 10:113793226-113793248 AAATAACTGTGTTGAGGTGATGG + Intergenic
1075296484 10:121280863-121280885 AAATATGGATCTTTAGCTGAGGG + Intergenic
1075582383 10:123631774-123631796 AAATATGTGGGCTTGGCTGAAGG + Intergenic
1077180753 11:1213340-1213362 AAAAATGTGTCTTCTGCTGTTGG - Intergenic
1077677556 11:4209742-4209764 AATAATGTATGTACAGCTGATGG - Intergenic
1078343172 11:10516471-10516493 AGCTCTGTGTGTTCAGCTCAGGG - Intronic
1078717476 11:13853849-13853871 GAATCTCTGTGGTCAGCTGATGG - Intergenic
1079139418 11:17798128-17798150 AAATAAGTGTGTTGAATTGATGG + Intronic
1079908204 11:26276042-26276064 AAATATGGGTGTTCTGCACAAGG + Intergenic
1080466185 11:32499488-32499510 AGATATATGTGTTTAGCTGGGGG + Intergenic
1080520936 11:33067490-33067512 AAACTTGTTTGCTCAGCTGAGGG + Intronic
1082154947 11:48797936-48797958 TAATGTGTGCATTCAGCTGACGG - Intergenic
1083100443 11:60299919-60299941 AAAAATGTTTGTAGAGCTGAAGG + Intronic
1084766889 11:71316864-71316886 AAGAATGTGTGTTCTGTTGATGG + Intergenic
1087872973 11:103321616-103321638 AAATATGTGTCTTCAGTTTCTGG + Intronic
1090513574 11:127400594-127400616 AAACATGTGTGTTGGGATGAAGG + Intergenic
1093504618 12:19850578-19850600 AAATATGTGTGTTTAGTTTCGGG + Intergenic
1093882680 12:24423703-24423725 AAATATTTCTATTCATCTGATGG + Intergenic
1094885427 12:34863872-34863894 TGATGTGTGTGTTCAGCTCACGG + Intergenic
1094890403 12:34945044-34945066 TGATGTGTGTGTTCAACTGAAGG + Intergenic
1094934240 12:35654759-35654781 TGATGTGTGTGTTCAACTGAAGG + Intergenic
1094951932 12:35941795-35941817 AGATGTGTGTGTTCAACTCAAGG + Intergenic
1094962451 12:36111642-36111664 TGATGTGTGTGTTCAACTGAAGG + Intergenic
1094965679 12:36163962-36163984 TGATGTGTGTGTTCAACTGAAGG + Intergenic
1094998158 12:36688338-36688360 TGATATGTGTGTTCAACTCAAGG + Intergenic
1095023948 12:37106463-37106485 TGATGTGTGTGTTCAGCTCAAGG + Intergenic
1095036222 12:37377651-37377673 AGATGTGTGTGTTCAACTAACGG - Intergenic
1098254269 12:68600480-68600502 AAATATGTGTGTATAGAAGAGGG + Intergenic
1099839730 12:87950419-87950441 AAATATCTGTGGTCACATGATGG + Intergenic
1100120236 12:91361034-91361056 AAATGTGTGTGTTTAGAGGAGGG - Intergenic
1100783566 12:98055243-98055265 AAATATGTGTGATAAGCACAAGG - Intergenic
1101086673 12:101243225-101243247 AAGTATGTCTGGTCAGCTTACGG + Intergenic
1101815058 12:108139926-108139948 AAGGTTGTGTGATCAGCTGATGG - Intronic
1103964470 12:124629909-124629931 CAATTTATCTGTTCAGCTGACGG + Intergenic
1104592748 12:130097835-130097857 AGTTACATGTGTTCAGCTGAGGG + Intergenic
1107091130 13:36481201-36481223 AAATTTGTTTGAGCAGCTGATGG - Intergenic
1110084957 13:71365849-71365871 AAATAAGTGTATTTAGCTTATGG + Intergenic
1110916167 13:81023543-81023565 AAATCTGTGTGCTCTGGTGATGG - Intergenic
1112377575 13:98857649-98857671 AAATCTGAGTGTTCAACAGAGGG - Intronic
1112607925 13:100926162-100926184 AGATGTGTGTGTTCACCTCAGGG + Intergenic
1114129109 14:19768789-19768811 AAGAATGTGTGTTCTGCTGTTGG + Intronic
1115768964 14:36650794-36650816 AAAGATATGTGTTCAGCCTATGG - Intergenic
1117171521 14:53104893-53104915 AAATATGTATGTACAAATGACGG - Intronic
1118090594 14:62472430-62472452 AAATAGGTATATTTAGCTGAAGG + Intergenic
1118195831 14:63625105-63625127 AAATATCTGTCATCTGCTGAAGG + Intronic
1120258409 14:82150583-82150605 AAATATGTTGATTCAGCTGTTGG + Intergenic
1122963129 14:105108366-105108388 TGAAATGTGTGTTCACCTGATGG + Intergenic
1123208337 14:106735514-106735536 AGATATGCTTGCTCAGCTGAAGG + Intergenic
1123423417 15:20148961-20148983 AAATGTGTGTGTTTTGCTGTTGG + Intergenic
1123532638 15:21155482-21155504 AAATGTGTGTGTTTTGCTGTTGG + Intergenic
1123572058 15:21623007-21623029 AAGAATGTGTGTTCTGCTGTTGG + Intergenic
1123608674 15:22065597-22065619 AAGAATGTGTGTTCTGCTGTTGG + Intergenic
1124112508 15:26805087-26805109 AAAAATGTTTGTACAGTTGAGGG + Intronic
1124123897 15:26918431-26918453 AAAAATGTGTATTCTGCTGCAGG + Intronic
1125029097 15:35058406-35058428 AAATATGTCTCTGCAGTTGAGGG + Intergenic
1125777348 15:42228815-42228837 AAATATGTGTTTGCAGGTCAAGG + Exonic
1126875745 15:53039114-53039136 CTATATGTGTGTCCAGATGATGG - Intergenic
1127098579 15:55538095-55538117 AAATATGTGTATCTCGCTGAAGG - Intergenic
1128525890 15:68412046-68412068 ACATATCTGGGGTCAGCTGAGGG - Intronic
1130156202 15:81352191-81352213 AAGTAAATGTGTTCAGCAGAGGG + Intronic
1132240816 15:100255930-100255952 GAAGAGGTGTGTTCAGCTCAGGG + Intronic
1202980915 15_KI270727v1_random:357393-357415 AAGAATGTGTGTTCTGCTGTTGG + Intergenic
1133895414 16:9922944-9922966 AAAAATGTGTGTTCTGTTGTTGG + Intronic
1134799071 16:17067870-17067892 AAAGAGGTGTATTCAGCTCATGG - Intergenic
1136861404 16:33706646-33706668 AAATGTGTGTGTTTTGCTGTTGG - Intergenic
1137991201 16:53157650-53157672 AAATATGTATGTTCACTTAATGG - Intronic
1138707762 16:58935131-58935153 AAATGTTTGTGTGCATCTGATGG - Intergenic
1139458480 16:67103395-67103417 AAATATTTTTGTGCAGATGAAGG - Intergenic
1140187932 16:72790892-72790914 AACTGTGTGTCTTCAACTGATGG + Intronic
1140804473 16:78520438-78520460 AAATATGTGTGTAAAACTGATGG - Intronic
1141476407 16:84276630-84276652 AAATATGTGTTTTTTGCTGGTGG + Intergenic
1203122903 16_KI270728v1_random:1554837-1554859 AAATGTGTGTGTTTTGCTGTTGG - Intergenic
1143981007 17:10869878-10869900 AGATATGTGAACTCAGCTGAAGG + Intergenic
1147454229 17:40526112-40526134 AAATGTGTGTTTTCATCTCATGG - Intergenic
1147458241 17:40552054-40552076 AAAAATGTATCTGCAGCTGAGGG + Intergenic
1149147394 17:53512460-53512482 ACATATATGTGTTCACCTGCAGG - Intergenic
1150800463 17:68277851-68277873 ATACATGTGTGTTAAACTGAAGG + Intronic
1151055673 17:71028163-71028185 AAATTTGTGTTTTCACCTTAAGG - Intergenic
1153755396 18:8277521-8277543 AAATATGTGTGATCACATAAAGG + Intronic
1155383967 18:25256782-25256804 ACAAGTGTGTGTGCAGCTGAAGG + Intronic
1156648462 18:39196352-39196374 AAATATGTGTTTTCAGTGGGGGG + Intergenic
1157084983 18:44570881-44570903 AAATATGTCTGATCTTCTGATGG + Intergenic
1166634499 19:44438354-44438376 AAATATTTTTGCTCATCTGATGG - Intronic
1167811646 19:51837765-51837787 AAATATCTATTTTCAGATGATGG + Intergenic
1202671135 1_KI270709v1_random:53465-53487 GAATATGAGTTTTCAGCAGATGG - Intergenic
1202693449 1_KI270712v1_random:106457-106479 AAATGTGTGTGTTTTGCTGTTGG + Intergenic
925052313 2:825927-825949 CAATATGTGTTTTTAGCAGAGGG + Intergenic
925197457 2:1937798-1937820 AAATCTGTGTGGTCACCTTAGGG - Intronic
925425169 2:3743436-3743458 AAAAATGTGTATTCCGCTGCTGG - Intronic
925459600 2:4049073-4049095 CAAGATGTGTGTTCAGCAAACGG + Intergenic
926080485 2:9981905-9981927 GAACTTGTGTGTTCAGCTGAAGG - Intronic
930514458 2:52388757-52388779 AAAAATGCATCTTCAGCTGAAGG + Intergenic
931577999 2:63740228-63740250 ATATATGTATATTCAGCTGTAGG + Intronic
932211487 2:69935204-69935226 AAATATGTTTATTCAGCAAAAGG + Intronic
932384282 2:71316740-71316762 AAAAATGTTTTTTCATCTGATGG + Intronic
932675080 2:73772625-73772647 AGATATGAGGGTACAGCTGATGG - Intronic
932929318 2:76015002-76015024 GAATATGTGTGTGGAGCTGCTGG + Intergenic
933953123 2:87348125-87348147 AAATGTGTGTGTTTTGCTGTTGG - Intergenic
934237354 2:90244470-90244492 AAATGTGTGTGTTTTGCTGTTGG - Intergenic
934459779 2:94207764-94207786 AAATGTGTGTGTTTTGCTGTTGG - Intergenic
936022744 2:109007198-109007220 AAATATGTGTTTTAAGTTAAAGG + Intergenic
937700150 2:124854943-124854965 AAGTAGGTGTTTTCAGCTAAGGG + Intronic
937811510 2:126204654-126204676 AAATATGTGTGTTTAGGAAAAGG - Intergenic
939513354 2:143134992-143135014 AAATATGAATGTTCAAGTGAAGG + Intronic
941065245 2:160894486-160894508 AAATACCTGTTTTGAGCTGAAGG - Intergenic
941970686 2:171347694-171347716 AAATATGTCTGTGCAGCTGCTGG + Intronic
942604124 2:177672498-177672520 AAATATGTGTCATCAGCTTGGGG + Intronic
943185887 2:184607199-184607221 AAACATGTGTGGTAAGCTGTTGG - Intronic
944738425 2:202589302-202589324 AGTTGTCTGTGTTCAGCTGAGGG - Intergenic
945616262 2:212072126-212072148 AAATGTGTGTATTCAGGTCAAGG + Intronic
946551953 2:220811490-220811512 AAATATGTGTATTTAGGAGAAGG + Intergenic
1171822174 20:29861107-29861129 AGATATGTGTATTCATCTCACGG + Intergenic
1172920249 20:38475000-38475022 CAATGTGTGTGTTCAACTGCTGG - Intronic
1175033105 20:55974530-55974552 GACTGTCTGTGTTCAGCTGAAGG + Intergenic
1178236064 21:30842742-30842764 AAATATTTCTTTTCATCTGAGGG - Intergenic
1180325609 22:11374955-11374977 AGATATGTGTATTCATCTCATGG + Intergenic
1180398691 22:12386918-12386940 ATATATTTGTGTTCAACTGTTGG - Intergenic
1181100212 22:20533834-20533856 AAATATGCTTGGTGAGCTGAAGG - Intronic
1181356420 22:22298692-22298714 AAATGTGTGTGTTTTGCTGTTGG + Intergenic
1183397623 22:37581462-37581484 TAATGTGAGTGTTCAGCAGAAGG - Intronic
949618052 3:5777073-5777095 AAATATGTGGGTAAATCTGAAGG - Intergenic
950358576 3:12433641-12433663 TAATCTGTGTGGTCAGCTGAGGG - Intronic
950694739 3:14690261-14690283 AAATCTGTGTGGACAGCTGCTGG - Intronic
950937268 3:16851788-16851810 AAATATTTGTGTGCAACTTAGGG + Intronic
951036467 3:17938356-17938378 AAATTTCTGTGTTGAGCTTATGG + Intronic
951170898 3:19540611-19540633 AAATCTGTGTTTCCATCTGAGGG - Intergenic
951598894 3:24350303-24350325 ATATATGTGTATTCAGCTTTAGG - Intronic
951928823 3:27940812-27940834 AATTATGTGTGGTCTGCTGAAGG - Intergenic
952835917 3:37601824-37601846 AAAGATGTGTATTCGGCTCATGG + Intronic
952897665 3:38088919-38088941 AAGCAGGTGTGATCAGCTGAAGG - Intronic
953239881 3:41139336-41139358 AAATGTGTATGTTCACCTGTGGG + Intergenic
953803104 3:46043869-46043891 AATTATGTGTGTTAACATGATGG + Intergenic
955233254 3:57118057-57118079 AAATGTTTGTTTGCAGCTGACGG + Intronic
955417716 3:58708229-58708251 AAATAGATCTGTTGAGCTGATGG + Intergenic
955499818 3:59572653-59572675 AAACAGGTGTGTTTAGCTGCTGG - Intergenic
956375783 3:68612119-68612141 AATTATGTGTGTTGAAGTGAGGG + Intergenic
957011631 3:75012256-75012278 AAATATGTTTATTTAGCTCATGG - Intergenic
957950446 3:87119209-87119231 AAATATGTATATTAAGATGAGGG - Intergenic
958272982 3:91530861-91530883 TGATATGTGCGTTCAACTGATGG - Intergenic
958662478 3:97088565-97088587 AAATCTGTGTCTTCAGGTGCAGG - Intronic
959615716 3:108345166-108345188 AAAAATGTGGCTTCAGGTGAAGG + Intronic
959840993 3:110974339-110974361 TAATATGACTGTTCAGATGAAGG + Intergenic
960195213 3:114758234-114758256 AAATATGAGTGTGCAAATGAAGG - Intronic
960684487 3:120283545-120283567 AAGTGTTTGTTTTCAGCTGAGGG - Intronic
961564161 3:127751544-127751566 ACACATGTGTGGTCAGCTGCAGG - Intronic
963982382 3:151553169-151553191 ACATCTGAGTGTTCTGCTGAAGG + Intergenic
964518194 3:157535151-157535173 AAGTCTGTGTGTTCCTCTGAGGG + Intergenic
965500680 3:169452695-169452717 AAGTATGTGTGCTCAGCTATTGG - Intronic
965670099 3:171139047-171139069 AAATATGACTGTAGAGCTGATGG + Intronic
966066162 3:175824769-175824791 ACATATTTGTTTTCAGCTAATGG + Intergenic
969134114 4:5016267-5016289 AAAGATGTTTGTTTAGCTTATGG - Intronic
969479329 4:7439479-7439501 AGATGTGTGTGTTTAGCTGTAGG - Intronic
972871773 4:43309258-43309280 AAATTTGTCTGGTCAGATGAGGG - Intergenic
976373459 4:84317151-84317173 AAATATGTAACTTTAGCTGATGG - Intergenic
977258036 4:94761719-94761741 AAATATGGGTATTCAGAGGATGG + Intronic
980060427 4:128122960-128122982 AAATATTTGTTTTCAGTAGAGGG + Intronic
980121700 4:128734600-128734622 AAATATCTGTATTCTGTTGAAGG + Intergenic
980946318 4:139323750-139323772 AAATAGCTGTTTTCAGCTGTTGG - Intronic
982580288 4:157169003-157169025 ATATATGTGTATTCAGGTAAAGG + Intronic
984501477 4:180564705-180564727 AAAGCTATGTGCTCAGCTGAAGG + Intergenic
984904914 4:184617693-184617715 AAATATGTGTTTCCAGCTTCTGG - Intergenic
985274352 4:188223430-188223452 AAATATCTGTGGTCAGCAGTTGG + Intergenic
986657017 5:10023627-10023649 AAGTATGTGTATTCTGCTGTAGG - Intergenic
988026010 5:25690831-25690853 GATTATGCATGTTCAGCTGATGG - Intergenic
988108323 5:26779975-26779997 AAACTTGTTTATTCAGCTGATGG - Intergenic
988185546 5:27856550-27856572 AAATATGTGATATCAGTTGAGGG + Intergenic
988282606 5:29169743-29169765 ATATACCTTTGTTCAGCTGAGGG + Intergenic
988788119 5:34582713-34582735 CAAACTGTCTGTTCAGCTGATGG - Intergenic
990405459 5:55485862-55485884 AAATAAGTAAGTTCAGCTGTAGG - Intronic
990669857 5:58115913-58115935 AAATATTTATGTGCAGGTGATGG + Intergenic
993660032 5:90622070-90622092 AAATATGCTGGTTCAGCTGGTGG - Intronic
995853473 5:116571267-116571289 CAATAAGTATATTCAGCTGATGG + Intronic
997329486 5:133049119-133049141 AAATATGAGTCCCCAGCTGATGG + Intergenic
999053624 5:148550361-148550383 ATATATGTGTCATCAGCTGATGG - Intronic
999302811 5:150501595-150501617 AAAGTTGTGTGTTCAGATGAGGG + Intronic
1001363568 5:171113198-171113220 AAAGATGTGTGATCACATGAAGG - Intronic
1002655129 5:180739881-180739903 ACATAGGTGTGTGCAGCCGAAGG + Exonic
1202774313 5_GL000208v1_random:51376-51398 GAATGTGTGTATTCAGCTCACGG - Intergenic
1004570965 6:16844538-16844560 ATATATGGGTGTTCTGTTGATGG + Intergenic
1005355378 6:24978216-24978238 AAATATTTTTGTTAAGCTGAAGG + Intronic
1006028679 6:31163383-31163405 AAATATATGGGTTGAGCTGGAGG + Exonic
1006643573 6:35500986-35501008 AAGGATGTGTGATCAGCTGACGG + Intronic
1006762870 6:36478784-36478806 AAATATCTGTGTTGAGATGGTGG - Intronic
1008771263 6:54981658-54981680 AAATATGTGTTTTCAAATCATGG - Intergenic
1010812869 6:80319643-80319665 GAATATGTGTATTCAGGTGTAGG + Intronic
1014633049 6:123811066-123811088 GAATATGTGTCTTCACCTAATGG + Intronic
1014977056 6:127900733-127900755 AAATATGTGAGTTCTGGTAAAGG - Intronic
1015573453 6:134646012-134646034 AAATCTGATTGTTGAGCTGAAGG - Intergenic
1016359645 6:143253593-143253615 AAATATGTATCATGAGCTGATGG + Intronic
1016371568 6:143379952-143379974 AAATTTGGGTCTTCTGCTGATGG + Intergenic
1016674384 6:146747260-146747282 AAATATGTGTATTCCCCAGAAGG + Intronic
1018179052 6:161204524-161204546 AGATAATTGTCTTCAGCTGAAGG - Intronic
1019135539 6:169905481-169905503 AGGTTTGTGTGTGCAGCTGATGG + Intergenic
1019974097 7:4566335-4566357 AAATATGTGTATTCTGTTGTTGG - Intergenic
1022019869 7:26388261-26388283 TAAAATGTGTGTTCAGCAGATGG + Intergenic
1022414181 7:30164032-30164054 AAATTGGGGTGTTCAGCTTAGGG + Intergenic
1023351667 7:39326437-39326459 AAATCTGTTTGCTCAGCAGATGG - Intronic
1024206846 7:47170523-47170545 ACATATATGTGTATAGCTGAAGG + Intergenic
1024431162 7:49289579-49289601 AAATATGTGTGCATAGATGATGG + Intergenic
1024896959 7:54271281-54271303 AGAGATGTGTACTCAGCTGAAGG + Intergenic
1025028533 7:55537214-55537236 AAATATGTGTGTTCAGCTGAAGG - Intronic
1027504345 7:78996782-78996804 AAATAAGTATGTTAAACTGAAGG + Intronic
1028161795 7:87494095-87494117 ACTTCTGTGGGTTCAGCTGAAGG - Intergenic
1028222541 7:88214323-88214345 AAATATGTTTGGTCAGGGGAGGG + Intronic
1030319491 7:108149506-108149528 ATATATAGGGGTTCAGCTGAGGG + Exonic
1031167132 7:118242548-118242570 AAATTTATCTTTTCAGCTGATGG - Exonic
1031388295 7:121180255-121180277 AGACAAGTGTTTTCAGCTGATGG + Intronic
1033829255 7:145232618-145232640 AAATATGTGGTGTTAGCTGAAGG - Intergenic
1035882492 8:3257594-3257616 AAATATGTGTCATCATCTCAGGG - Intronic
1036568425 8:9958134-9958156 AAATGTGTGTGTACAGTTGGAGG + Intergenic
1037413052 8:18618103-18618125 AAATATTTGAGTTAAGTTGAGGG - Intronic
1039209130 8:35191639-35191661 AAACATTTGTTTTCAGATGAAGG - Intergenic
1040372434 8:46789833-46789855 AGCTCTGTGTGTTCAACTGAAGG + Intergenic
1040380453 8:46867203-46867225 AGCTCTGTGTGTTCAACTGAAGG - Intergenic
1040751124 8:50709890-50709912 AAATATGTGTGTTCTGGTAAAGG - Intronic
1041959948 8:63601757-63601779 AAATATGCATTTTCATCTGATGG + Intergenic
1042367108 8:67950237-67950259 AAATATGTGTCTGCAGATCAGGG + Intergenic
1043571324 8:81606167-81606189 AAATATTTGCTTTGAGCTGATGG - Intergenic
1045061553 8:98415666-98415688 AACTTTCTGTGTTCAGATGAAGG - Intronic
1045384923 8:101663094-101663116 AAATCTTTGTGTGCATCTGAAGG + Intronic
1046516668 8:115271221-115271243 AAATATGTGAGTTCAGATGTAGG - Intergenic
1050397355 9:5213664-5213686 AAATTCTTGTGTACAGCTGAAGG + Intergenic
1052049895 9:23832692-23832714 AACTATGTGTTGTCGGCTGAAGG - Intergenic
1053690282 9:40583577-40583599 AAATGTGTGTGTTTTGCTGTTGG - Intergenic
1054274396 9:63053451-63053473 AGAAATGTGTGTACAGTTGATGG + Intergenic
1054301533 9:63384538-63384560 AAATGTGTGTGTTTTGCTGTTGG - Intergenic
1054400428 9:64711478-64711500 AGAAATGTGTGTACAGTTGATGG - Intergenic
1054434018 9:65195734-65195756 AGAAATGTGTGTACAGTTGATGG - Intergenic
1054496369 9:65825934-65825956 AGAAATGTGTGTACAGTTGATGG + Intergenic
1055348885 9:75364430-75364452 AAATATGTGTAATCGCCTGATGG - Intergenic
1055532361 9:77197221-77197243 AAAAATGTGTATTCTGCTGTTGG + Intronic
1055706082 9:79005939-79005961 AAATATGTGTGTTTAGGGAATGG - Intergenic
1058337735 9:103853789-103853811 CAATATGTGTGTTCAGAAGGTGG + Intergenic
1060248474 9:121966428-121966450 AAATATCTATGTTCAGGAGAAGG + Intronic
1203418077 Un_KI270366v1:2138-2160 GAATGTGTGTATTCAGCTCACGG - Intergenic
1185863642 X:3603300-3603322 AAGCATGTTTGTTCTGCTGAAGG + Intergenic
1186585072 X:10864748-10864770 ATATATGTGTGCTCAGATAATGG + Intergenic
1186952918 X:14647228-14647250 AAACATTTGTCTTCAGCTGTGGG + Intronic
1187224922 X:17366742-17366764 AAAGATGTGGGTTCAGGAGAAGG + Intergenic
1187535420 X:20137484-20137506 ATATGTGTGTGTACAGATGAAGG + Intronic
1188014713 X:25095771-25095793 AAAAATGTGTATTCTGCTGTTGG + Intergenic
1188985108 X:36762124-36762146 AAATATGTGTGTGGAGGTGGGGG - Intergenic
1190802677 X:53806498-53806520 AAATATGTGTATTCTGCTATTGG - Intergenic
1191575487 X:62700227-62700249 AAATATGTGGATTCATCTCACGG - Intergenic
1192256765 X:69467857-69467879 AAAGATGTTTATTTAGCTGATGG - Intergenic
1192260309 X:69502335-69502357 AAATATGTGTCTTGAGCTGAAGG - Intergenic
1193213738 X:78838690-78838712 AAATCTGTGTGTTCTGGGGAGGG + Intergenic
1195601223 X:106751258-106751280 AAATCTGTGTGTTTAGGGGAAGG + Intronic
1196125450 X:112093947-112093969 AATTATGTGTGGTCATGTGAGGG + Intergenic
1196266690 X:113657169-113657191 AAGTGTGTTTGTTCAGGTGAGGG - Intergenic
1196534868 X:116831953-116831975 AAATATCTGTGCTCAGATAATGG - Intergenic
1197540068 X:127747692-127747714 AAGAATGTGTGTTCAGTTGTTGG + Intergenic
1198892159 X:141409979-141410001 AAATATGTCTGTTCAGGGAAAGG + Intergenic
1199726456 X:150587554-150587576 AAATATATGTGTTAAATTGATGG + Intronic
1201715687 Y:17042544-17042566 AAATATGTGTGTCCTGCACATGG + Intergenic
1202256816 Y:22929776-22929798 AGCTCTGTGTGTTCAACTGAAGG + Intergenic
1202409808 Y:24563529-24563551 AGCTCTGTGTGTTCAACTGAAGG + Intergenic
1202460975 Y:25106548-25106570 AGCTCTGTGTGTTCAACTGAAGG - Intergenic