ID: 1025035066

View in Genome Browser
Species Human (GRCh38)
Location 7:55588805-55588827
Sequence CAGAGTCAGGAGAATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025035066_1025035072 -4 Left 1025035066 7:55588805-55588827 CCTGCCCCATTCTCCTGACTCTG No data
Right 1025035072 7:55588824-55588846 TCTGTCTACCTCTGTCTCTAGGG No data
1025035066_1025035074 12 Left 1025035066 7:55588805-55588827 CCTGCCCCATTCTCCTGACTCTG No data
Right 1025035074 7:55588840-55588862 TCTAGGGTCTCCCTGAACTCAGG No data
1025035066_1025035077 22 Left 1025035066 7:55588805-55588827 CCTGCCCCATTCTCCTGACTCTG No data
Right 1025035077 7:55588850-55588872 CCCTGAACTCAGGGTCCCAATGG No data
1025035066_1025035075 13 Left 1025035066 7:55588805-55588827 CCTGCCCCATTCTCCTGACTCTG No data
Right 1025035075 7:55588841-55588863 CTAGGGTCTCCCTGAACTCAGGG No data
1025035066_1025035071 -5 Left 1025035066 7:55588805-55588827 CCTGCCCCATTCTCCTGACTCTG No data
Right 1025035071 7:55588823-55588845 CTCTGTCTACCTCTGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025035066 Original CRISPR CAGAGTCAGGAGAATGGGGC AGG (reversed) Intergenic
No off target data available for this crispr