ID: 1025036657

View in Genome Browser
Species Human (GRCh38)
Location 7:55597461-55597483
Sequence TTCAGACAGAAGTGGTACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025036657_1025036659 12 Left 1025036657 7:55597461-55597483 CCGTGGTACCACTTCTGTCTGAA No data
Right 1025036659 7:55597496-55597518 GCACAGTCTCTTGTTCTCCTAGG No data
1025036657_1025036660 26 Left 1025036657 7:55597461-55597483 CCGTGGTACCACTTCTGTCTGAA No data
Right 1025036660 7:55597510-55597532 TCTCCTAGGAAACACCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025036657 Original CRISPR TTCAGACAGAAGTGGTACCA CGG (reversed) Intergenic
No off target data available for this crispr