ID: 1025040637

View in Genome Browser
Species Human (GRCh38)
Location 7:55641525-55641547
Sequence GTTCAGTAACACCATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025040637_1025040638 -7 Left 1025040637 7:55641525-55641547 CCTACAGCATGGTGTTACTGAAC No data
Right 1025040638 7:55641541-55641563 ACTGAACAGCCACTGTGATTTGG No data
1025040637_1025040640 5 Left 1025040637 7:55641525-55641547 CCTACAGCATGGTGTTACTGAAC No data
Right 1025040640 7:55641553-55641575 CTGTGATTTGGCATCTCCTTTGG No data
1025040637_1025040642 27 Left 1025040637 7:55641525-55641547 CCTACAGCATGGTGTTACTGAAC No data
Right 1025040642 7:55641575-55641597 GCTAAATAACTAAATTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025040637 Original CRISPR GTTCAGTAACACCATGCTGT AGG (reversed) Intergenic