ID: 1025040640 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:55641553-55641575 |
| Sequence | CTGTGATTTGGCATCTCCTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1025040637_1025040640 | 5 | Left | 1025040637 | 7:55641525-55641547 | CCTACAGCATGGTGTTACTGAAC | No data | ||
| Right | 1025040640 | 7:55641553-55641575 | CTGTGATTTGGCATCTCCTTTGG | No data | ||||
| 1025040635_1025040640 | 21 | Left | 1025040635 | 7:55641509-55641531 | CCTATGAAACATAGCTCCTACAG | No data | ||
| Right | 1025040640 | 7:55641553-55641575 | CTGTGATTTGGCATCTCCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1025040640 | Original CRISPR | CTGTGATTTGGCATCTCCTT TGG | Intergenic | ||