ID: 1025040642 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:55641575-55641597 |
Sequence | GCTAAATAACTAAATTTCCC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1025040637_1025040642 | 27 | Left | 1025040637 | 7:55641525-55641547 | CCTACAGCATGGTGTTACTGAAC | No data | ||
Right | 1025040642 | 7:55641575-55641597 | GCTAAATAACTAAATTTCCCAGG | No data | ||||
1025040639_1025040642 | 2 | Left | 1025040639 | 7:55641550-55641572 | CCACTGTGATTTGGCATCTCCTT | No data | ||
Right | 1025040642 | 7:55641575-55641597 | GCTAAATAACTAAATTTCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1025040642 | Original CRISPR | GCTAAATAACTAAATTTCCC AGG | Intergenic | ||