ID: 1025047396

View in Genome Browser
Species Human (GRCh38)
Location 7:55703580-55703602
Sequence CTCATTATGGTTCCTGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025047396_1025047402 23 Left 1025047396 7:55703580-55703602 CCAAAGCCAGGAACCATAATGAG No data
Right 1025047402 7:55703626-55703648 TAAAAGGTTTACAGTTAAATGGG No data
1025047396_1025047400 7 Left 1025047396 7:55703580-55703602 CCAAAGCCAGGAACCATAATGAG No data
Right 1025047400 7:55703610-55703632 AATGTATTTAACAACATAAAAGG No data
1025047396_1025047401 22 Left 1025047396 7:55703580-55703602 CCAAAGCCAGGAACCATAATGAG No data
Right 1025047401 7:55703625-55703647 ATAAAAGGTTTACAGTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025047396 Original CRISPR CTCATTATGGTTCCTGGCTT TGG (reversed) Intergenic
No off target data available for this crispr