ID: 1025048378

View in Genome Browser
Species Human (GRCh38)
Location 7:55712611-55712633
Sequence TATTTGGAATTCTGAAGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025048378_1025048386 18 Left 1025048378 7:55712611-55712633 CCCGGTCTTCAGAATTCCAAATA No data
Right 1025048386 7:55712652-55712674 AAATGAAGCACTGAATTGGGGGG No data
1025048378_1025048385 17 Left 1025048378 7:55712611-55712633 CCCGGTCTTCAGAATTCCAAATA No data
Right 1025048385 7:55712651-55712673 AAAATGAAGCACTGAATTGGGGG No data
1025048378_1025048383 15 Left 1025048378 7:55712611-55712633 CCCGGTCTTCAGAATTCCAAATA No data
Right 1025048383 7:55712649-55712671 TCAAAATGAAGCACTGAATTGGG No data
1025048378_1025048384 16 Left 1025048378 7:55712611-55712633 CCCGGTCTTCAGAATTCCAAATA No data
Right 1025048384 7:55712650-55712672 CAAAATGAAGCACTGAATTGGGG No data
1025048378_1025048382 14 Left 1025048378 7:55712611-55712633 CCCGGTCTTCAGAATTCCAAATA No data
Right 1025048382 7:55712648-55712670 ATCAAAATGAAGCACTGAATTGG No data
1025048378_1025048387 19 Left 1025048378 7:55712611-55712633 CCCGGTCTTCAGAATTCCAAATA No data
Right 1025048387 7:55712653-55712675 AATGAAGCACTGAATTGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025048378 Original CRISPR TATTTGGAATTCTGAAGACC GGG (reversed) Intergenic