ID: 1025048379

View in Genome Browser
Species Human (GRCh38)
Location 7:55712612-55712634
Sequence ATATTTGGAATTCTGAAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 259}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025048379_1025048383 14 Left 1025048379 7:55712612-55712634 CCGGTCTTCAGAATTCCAAATAT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 1025048383 7:55712649-55712671 TCAAAATGAAGCACTGAATTGGG No data
1025048379_1025048384 15 Left 1025048379 7:55712612-55712634 CCGGTCTTCAGAATTCCAAATAT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 1025048384 7:55712650-55712672 CAAAATGAAGCACTGAATTGGGG No data
1025048379_1025048387 18 Left 1025048379 7:55712612-55712634 CCGGTCTTCAGAATTCCAAATAT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 1025048387 7:55712653-55712675 AATGAAGCACTGAATTGGGGGGG No data
1025048379_1025048386 17 Left 1025048379 7:55712612-55712634 CCGGTCTTCAGAATTCCAAATAT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 1025048386 7:55712652-55712674 AAATGAAGCACTGAATTGGGGGG No data
1025048379_1025048385 16 Left 1025048379 7:55712612-55712634 CCGGTCTTCAGAATTCCAAATAT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 1025048385 7:55712651-55712673 AAAATGAAGCACTGAATTGGGGG No data
1025048379_1025048382 13 Left 1025048379 7:55712612-55712634 CCGGTCTTCAGAATTCCAAATAT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 1025048382 7:55712648-55712670 ATCAAAATGAAGCACTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025048379 Original CRISPR ATATTTGGAATTCTGAAGAC CGG (reversed) Intergenic