ID: 1025048381

View in Genome Browser
Species Human (GRCh38)
Location 7:55712635-55712657
Sequence TCATTTTGATGTACTTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025048381_1025048387 -5 Left 1025048381 7:55712635-55712657 CCATCAGAAGTACATCAAAATGA No data
Right 1025048387 7:55712653-55712675 AATGAAGCACTGAATTGGGGGGG No data
1025048381_1025048382 -10 Left 1025048381 7:55712635-55712657 CCATCAGAAGTACATCAAAATGA No data
Right 1025048382 7:55712648-55712670 ATCAAAATGAAGCACTGAATTGG No data
1025048381_1025048386 -6 Left 1025048381 7:55712635-55712657 CCATCAGAAGTACATCAAAATGA No data
Right 1025048386 7:55712652-55712674 AAATGAAGCACTGAATTGGGGGG No data
1025048381_1025048385 -7 Left 1025048381 7:55712635-55712657 CCATCAGAAGTACATCAAAATGA No data
Right 1025048385 7:55712651-55712673 AAAATGAAGCACTGAATTGGGGG No data
1025048381_1025048383 -9 Left 1025048381 7:55712635-55712657 CCATCAGAAGTACATCAAAATGA No data
Right 1025048383 7:55712649-55712671 TCAAAATGAAGCACTGAATTGGG No data
1025048381_1025048384 -8 Left 1025048381 7:55712635-55712657 CCATCAGAAGTACATCAAAATGA No data
Right 1025048384 7:55712650-55712672 CAAAATGAAGCACTGAATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025048381 Original CRISPR TCATTTTGATGTACTTCTGA TGG (reversed) Intergenic