ID: 1025048387

View in Genome Browser
Species Human (GRCh38)
Location 7:55712653-55712675
Sequence AATGAAGCACTGAATTGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025048380_1025048387 3 Left 1025048380 7:55712627-55712649 CCAAATATCCATCAGAAGTACAT No data
Right 1025048387 7:55712653-55712675 AATGAAGCACTGAATTGGGGGGG No data
1025048378_1025048387 19 Left 1025048378 7:55712611-55712633 CCCGGTCTTCAGAATTCCAAATA No data
Right 1025048387 7:55712653-55712675 AATGAAGCACTGAATTGGGGGGG No data
1025048381_1025048387 -5 Left 1025048381 7:55712635-55712657 CCATCAGAAGTACATCAAAATGA No data
Right 1025048387 7:55712653-55712675 AATGAAGCACTGAATTGGGGGGG No data
1025048379_1025048387 18 Left 1025048379 7:55712612-55712634 CCGGTCTTCAGAATTCCAAATAT 0: 1
1: 0
2: 1
3: 21
4: 259
Right 1025048387 7:55712653-55712675 AATGAAGCACTGAATTGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025048387 Original CRISPR AATGAAGCACTGAATTGGGG GGG Intergenic