ID: 1025054548

View in Genome Browser
Species Human (GRCh38)
Location 7:55754314-55754336
Sequence TAGCCTTAATGGACCTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025054548_1025054554 12 Left 1025054548 7:55754314-55754336 CCAAACTAGGTCCATTAAGGCTA No data
Right 1025054554 7:55754349-55754371 CAGCAGGGCTGCATTCCTTCTGG 0: 32
1: 77
2: 198
3: 384
4: 774
1025054548_1025054551 -4 Left 1025054548 7:55754314-55754336 CCAAACTAGGTCCATTAAGGCTA No data
Right 1025054551 7:55754333-55754355 GCTAAAGTCAAGGTGCCAGCAGG No data
1025054548_1025054552 -3 Left 1025054548 7:55754314-55754336 CCAAACTAGGTCCATTAAGGCTA No data
Right 1025054552 7:55754334-55754356 CTAAAGTCAAGGTGCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025054548 Original CRISPR TAGCCTTAATGGACCTAGTT TGG (reversed) Intergenic
No off target data available for this crispr