ID: 1025061525

View in Genome Browser
Species Human (GRCh38)
Location 7:55812799-55812821
Sequence GTTTAGTATGGTGCTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025061525_1025061533 6 Left 1025061525 7:55812799-55812821 CCCCCAGCAGCACCATACTAAAC 0: 1
1: 0
2: 3
3: 14
4: 125
Right 1025061533 7:55812828-55812850 AGAATCTGTGTGTTTTGGGGAGG 0: 1
1: 8
2: 51
3: 187
4: 717
1025061525_1025061531 2 Left 1025061525 7:55812799-55812821 CCCCCAGCAGCACCATACTAAAC 0: 1
1: 0
2: 3
3: 14
4: 125
Right 1025061531 7:55812824-55812846 AGAGAGAATCTGTGTGTTTTGGG 0: 3
1: 4
2: 78
3: 191
4: 765
1025061525_1025061535 25 Left 1025061525 7:55812799-55812821 CCCCCAGCAGCACCATACTAAAC 0: 1
1: 0
2: 3
3: 14
4: 125
Right 1025061535 7:55812847-55812869 GAGGGAGAGTGAAGTGATTGTGG 0: 3
1: 23
2: 72
3: 185
4: 655
1025061525_1025061530 1 Left 1025061525 7:55812799-55812821 CCCCCAGCAGCACCATACTAAAC 0: 1
1: 0
2: 3
3: 14
4: 125
Right 1025061530 7:55812823-55812845 GAGAGAGAATCTGTGTGTTTTGG No data
1025061525_1025061534 7 Left 1025061525 7:55812799-55812821 CCCCCAGCAGCACCATACTAAAC 0: 1
1: 0
2: 3
3: 14
4: 125
Right 1025061534 7:55812829-55812851 GAATCTGTGTGTTTTGGGGAGGG No data
1025061525_1025061532 3 Left 1025061525 7:55812799-55812821 CCCCCAGCAGCACCATACTAAAC 0: 1
1: 0
2: 3
3: 14
4: 125
Right 1025061532 7:55812825-55812847 GAGAGAATCTGTGTGTTTTGGGG No data
1025061525_1025061536 26 Left 1025061525 7:55812799-55812821 CCCCCAGCAGCACCATACTAAAC 0: 1
1: 0
2: 3
3: 14
4: 125
Right 1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025061525 Original CRISPR GTTTAGTATGGTGCTGCTGG GGG (reversed) Intronic
905087185 1:35391233-35391255 GTTTTACATGGTCCTGCTGGAGG + Intronic
905124004 1:35704259-35704281 GTTTAGTAAGGGGCTCCTGAAGG + Intergenic
905141716 1:35851267-35851289 GTTTAATTTGGAGCTGCTTGTGG + Intronic
906128128 1:43439930-43439952 CATTAGTATTGTGCAGCTGGAGG + Exonic
906146607 1:43564288-43564310 GCTGAGGATGGAGCTGCTGGAGG + Intronic
907965380 1:59323818-59323840 GTTTCCTATGGTGGTGCTGATGG + Intronic
908840765 1:68278019-68278041 GGTTAGAATGGTGGTGGTGGTGG - Intergenic
913371187 1:118101718-118101740 GGTCAGTAAGGTGCTGCTGCCGG - Exonic
915675152 1:157522978-157523000 GATGAGGTTGGTGCTGCTGGTGG + Intronic
924597675 1:245461598-245461620 GTGAAGGATGGTGCAGCTGGAGG - Intronic
1064297378 10:14090566-14090588 CTTTAGCATGGAGCGGCTGGGGG - Intronic
1067027105 10:42852789-42852811 ACTCAGTATGGTGCTGGTGGAGG - Intergenic
1067037782 10:42932569-42932591 GATTAGGATGGAGCTGGTGGGGG - Intergenic
1067785233 10:49241080-49241102 GTGTAGGCTGGAGCTGCTGGAGG - Intergenic
1070906154 10:80075213-80075235 GTTTAGTGTTGAGCTGTTGGTGG + Intergenic
1072670748 10:97427137-97427159 GTACAGTCTGGTGCTCCTGGAGG + Intronic
1085163114 11:74367421-74367443 GTTTAGAATGGTGATGGTAGAGG + Intronic
1086594030 11:88549654-88549676 GTATAGTATGGCACTGGTGGTGG + Intronic
1088250556 11:107858167-107858189 GTTAAGTTTTGTGCTGCTGCCGG - Intronic
1089408555 11:118219524-118219546 GTTTTATAGGGTGGTGCTGGAGG - Intronic
1089500362 11:118928439-118928461 ATTTACTTTGGGGCTGCTGGGGG + Intronic
1091312203 11:134582587-134582609 GGTGAGGATGTTGCTGCTGGGGG - Intergenic
1095605495 12:44062530-44062552 GTTTAGAATGTTGCTGATGATGG + Intronic
1098550386 12:71755186-71755208 GTTCAAGGTGGTGCTGCTGGGGG + Exonic
1100173217 12:92001019-92001041 ATTGAGAATGGTGCTGCTGGGGG - Intronic
1101951361 12:109178761-109178783 GTTTTATAGGGTGGTGCTGGAGG + Intronic
1103630564 12:122256626-122256648 GTTTATGATGCTGCTGCTGCTGG - Intronic
1109368824 13:61394871-61394893 TTTTAGTGTAGTGCTGCTGGTGG - Intergenic
1110360480 13:74619587-74619609 GATGATTATGGTGCTGATGGTGG - Intergenic
1111972040 13:94926655-94926677 GTTGAGGCTGGTGCTGCAGGTGG - Intergenic
1112055647 13:95688385-95688407 GTTTAGTATGGTGTTGGCTGTGG + Intronic
1112809668 13:103203374-103203396 ATTTACTAGGGTGCTGCAGGGGG + Intergenic
1115380227 14:32728729-32728751 CTTTTGTATGGTGCTTCTGTTGG - Intronic
1115910670 14:38254337-38254359 CTTTAGGATGGTGATACTGGGGG - Exonic
1116387835 14:44354227-44354249 GATTAGGATTGTGCTGCTGAAGG + Intergenic
1119381029 14:74228366-74228388 GTTTAGTCTGTTGCTGATGGTGG - Intergenic
1120929992 14:89838698-89838720 ATTTAGTATGATGTTGCTGTAGG - Intronic
1123426728 15:20177309-20177331 ACTCAGTATGGTGCTGGTGGAGG - Intergenic
1123535959 15:21183836-21183858 ACTCAGTATGGTGCTGGTGGAGG - Intergenic
1126372259 15:47959945-47959967 GTTTTGTAAGGTGCTGAGGGAGG - Intergenic
1129483735 15:75847981-75848003 ATTTAGTATCTTGCTGTTGGGGG - Intronic
1129923403 15:79339899-79339921 GATTAGGATGGTGATGGTGGTGG + Intronic
1130135071 15:81175588-81175610 GTTTATGATGGTGATGATGGTGG - Intronic
1131528796 15:93174505-93174527 GATTAAGATGGTGCTGGTGGAGG - Intergenic
1133436871 16:5787256-5787278 GTTTAGGATTGTGCTGCTTGGGG + Intergenic
1133571537 16:7045212-7045234 GTGGAGTATGGTGGTGGTGGTGG + Intronic
1134832294 16:17333496-17333518 GTTTAGAATGATGATTCTGGAGG + Intronic
1135916575 16:26610454-26610476 GATTAGTCTGATGTTGCTGGTGG - Intergenic
1136857521 16:33672196-33672218 ACTCAGTATGGTGCTGGTGGAGG + Intergenic
1139661284 16:68422613-68422635 GTTTAGTTTGATGATGCTGAGGG + Intronic
1140891059 16:79285609-79285631 GTTTACCATGGTGATTCTGGTGG + Intergenic
1141737876 16:85867096-85867118 GTTTAGTGTGGAGCTGCCAGGGG + Intergenic
1203119094 16_KI270728v1_random:1520681-1520703 ACTCAGTATGGTGCTGGTGGAGG + Intergenic
1152006999 17:77688585-77688607 CCTTAGCATGGGGCTGCTGGAGG - Intergenic
1160820712 19:1056433-1056455 GTTGAGTGTGGTGATGCTGTGGG - Exonic
1161959992 19:7517894-7517916 GCTCAGAATGCTGCTGCTGGAGG + Intronic
928620629 2:33084384-33084406 GGTTGGGAAGGTGCTGCTGGTGG + Intronic
929633918 2:43496730-43496752 GTATAAAATGGTGCTGCTGCTGG + Intronic
931202965 2:60118199-60118221 GTATAGTGTCGTGGTGCTGGTGG + Intergenic
931966273 2:67538752-67538774 ATTTAGTATGATGCTGGTTGTGG + Intergenic
932086831 2:68769940-68769962 GTTTAGGAGGGAGATGCTGGGGG + Intronic
932298710 2:70647966-70647988 GTTTGTGATGGTACTGCTGGGGG + Intronic
932870978 2:75397566-75397588 ATTCAGTATGGTGTTGGTGGTGG - Intergenic
934898847 2:98141141-98141163 GTTTCATGTGGTGCTGCTGAAGG + Intronic
935740162 2:106140305-106140327 GTTTAATTTGGAGCTGTTGGAGG - Intronic
936920391 2:117683077-117683099 GTATAGGATGGTGGTGGTGGTGG - Intergenic
938689876 2:133777631-133777653 GTTTTGAATGTAGCTGCTGGTGG - Intergenic
938759545 2:134411668-134411690 GTTTAGAAAGGTTCAGCTGGAGG - Intronic
941017351 2:160372361-160372383 GTTTGGGATGGTGGTGGTGGTGG - Intronic
947093835 2:226543856-226543878 TTTTAGTATAGTGCTGCTGAAGG - Intergenic
947333418 2:229054501-229054523 GTTTATTTTGGTGGTGGTGGTGG + Intronic
947398244 2:229707554-229707576 GTTTAGTGGGGTGCAGCTGTGGG - Intronic
948731194 2:239964714-239964736 TTTGAGTGTGGTTCTGCTGGAGG - Intronic
1168987769 20:2064976-2064998 GTTGGGGAGGGTGCTGCTGGTGG - Intergenic
1171063443 20:21988767-21988789 TTTTAGTATAGGTCTGCTGGTGG - Intergenic
1172301458 20:33853257-33853279 GTTTTGTCTGGGCCTGCTGGAGG + Intronic
1176926732 21:14758951-14758973 ATTTAGTTTGGTGATGGTGGTGG + Intergenic
1176948580 21:15015994-15016016 ATTTAGTAGGGTGCTGCTGGTGG - Intronic
1184591056 22:45483597-45483619 GTTTTGTAGAGTCCTGCTGGAGG - Intergenic
950849227 3:16046569-16046591 GTTTGGTGTGGTGGTGGTGGTGG + Intergenic
954148673 3:48646900-48646922 GTTTTCTATGCTGCTGCTTGTGG + Exonic
955127883 3:56132457-56132479 GTTGTGTAAGGTGCTGGTGGAGG - Intronic
955317293 3:57949413-57949435 GCTGAGCATGGTGCTGCTGGTGG + Intergenic
955784498 3:62522563-62522585 GTTTATTAGGATGATGCTGGGGG - Intronic
956627757 3:71283303-71283325 GTTTAGAAGGGTGCTGCTGGGGG - Intronic
961534857 3:127564089-127564111 GGTGATGATGGTGCTGCTGGTGG - Intergenic
965383972 3:168023859-168023881 GTTTATTGTGGTGCTGCTTACGG - Intronic
968598004 4:1495207-1495229 GGTTTGTCTGTTGCTGCTGGAGG + Intergenic
970233972 4:13940018-13940040 GTTTATTGTGGTGGTGGTGGTGG - Intergenic
980323311 4:131307555-131307577 GATTAATACAGTGCTGCTGGTGG - Intergenic
980614424 4:135200186-135200208 GTTTAGCTTGGTTCTGGTGGTGG + Intergenic
983253934 4:165377888-165377910 GGTTGGTAAGGTGCTGCTGGAGG - Intronic
983836249 4:172389818-172389840 GTTGAGTAAAGGGCTGCTGGAGG + Intronic
987005336 5:13704376-13704398 GTCTAGTGTAGTGCTGCTGGTGG + Intronic
989638780 5:43563401-43563423 GTCTAGTAAGGTGGTGCTAGTGG + Intergenic
990378761 5:55200824-55200846 GTTGGGTATGGTGGTGGTGGTGG + Intergenic
990961789 5:61401226-61401248 GGTTGGGATGGTGGTGCTGGTGG + Intronic
995995097 5:118288441-118288463 GTTTAGTATGATGTTGCTGTGGG + Intergenic
999836440 5:155378382-155378404 GTTTAGCATGATGGTGATGGTGG + Intergenic
1000190851 5:158909249-158909271 GGTTAGGATGGTGGTGCTGGTGG + Intronic
1001557800 5:172648089-172648111 GGTTAATCTGCTGCTGCTGGGGG - Intronic
1002282957 5:178143901-178143923 GTTTAGTGTAGAGCTGGTGGGGG - Intronic
1002846367 6:948681-948703 GATTGGAATGGTGGTGCTGGAGG + Intergenic
1004141250 6:13019968-13019990 GTTCAATGTGGTACTGCTGGTGG + Intronic
1006482690 6:34310550-34310572 GGTTATTATGGTGGTGGTGGTGG - Intronic
1008240316 6:49102129-49102151 GTTTAGTTTGGTGTTACTGCAGG - Intergenic
1008454378 6:51691953-51691975 GTTTAGTATGTTGGAGATGGAGG - Intronic
1010832717 6:80550987-80551009 TTTTATTAAGGTCCTGCTGGAGG + Intergenic
1012117996 6:95328495-95328517 CTCTATTATGGTTCTGCTGGGGG - Intergenic
1014074059 6:117216377-117216399 GTTCAGTTTGGTGTTGCTGCAGG + Intergenic
1014141019 6:117942162-117942184 GTTTAAGATGATGCAGCTGGTGG + Intronic
1019175481 6:170157269-170157291 GTTTGCTATGGTGTTGCTGCAGG - Intergenic
1021936384 7:25636265-25636287 GTTTAGTGTTGGGCGGCTGGTGG - Intergenic
1022325300 7:29325461-29325483 TCATAGTATGGTGCTGATGGAGG - Intronic
1022606655 7:31822011-31822033 GCTTAGACTGGTGGTGCTGGTGG + Intronic
1025061525 7:55812799-55812821 GTTTAGTATGGTGCTGCTGGGGG - Intronic
1025756624 7:64350793-64350815 GTTTTGTTTGGTGGTGGTGGTGG + Exonic
1027462057 7:78466609-78466631 GTTTTAAATGGTGCTGCTGTAGG + Intronic
1027503457 7:78984523-78984545 GCCAAGTATGGTCCTGCTGGAGG + Intronic
1027707041 7:81548542-81548564 GCTGATTATGGTGCTCCTGGTGG + Intergenic
1027845964 7:83375375-83375397 ATTTATTATGGTGCTGTTGTTGG - Intronic
1028167314 7:87552629-87552651 TTTTAGTATAGTGATGCTGTGGG - Intronic
1035022473 7:155807696-155807718 GTTTACCCTGCTGCTGCTGGTGG + Intronic
1035405467 7:158594262-158594284 GGTTATTATGGTGCTGCTGAAGG + Intergenic
1035405510 7:158594579-158594601 GGTTACTGTGGTGGTGCTGGAGG + Intergenic
1040966940 8:53092211-53092233 GTTTAGTATAATGTTGCTGTGGG + Intergenic
1041764484 8:61404080-61404102 GATTCTTATGGAGCTGCTGGCGG + Intronic
1042322547 8:67492705-67492727 TTATAGTCTGGTGCTACTGGTGG + Intronic
1042786341 8:72550946-72550968 GCTCAGAATGCTGCTGCTGGAGG + Intronic
1043506582 8:80908828-80908850 GTTTAGAATGATGTTGCTGGAGG + Intergenic
1047928814 8:129706107-129706129 GTTTAGGAAGGTGATGCTGCTGG + Intergenic
1048153311 8:131915581-131915603 GATTAGAATGGTGCTATTGGGGG + Intronic
1051162178 9:14221015-14221037 GTTTAGTATCTTGCTGCTGATGG - Intronic
1052098955 9:24419776-24419798 GTTGACTATTGTGCTGCTTGCGG + Intergenic
1055755374 9:79552189-79552211 ATTCAGTATGGTGCTGCAAGAGG - Intergenic
1056278772 9:85019295-85019317 GTGTAGCATGGTGGTGCTGGGGG + Intronic
1056966968 9:91171337-91171359 ATTTAGTATGGTGCTGGCTGTGG - Intergenic
1061062036 9:128255301-128255323 CATTACTAGGGTGCTGCTGGGGG + Intergenic
1187671608 X:21671957-21671979 GTTTACTATGGTGTTAATGGTGG - Intergenic
1189420743 X:40855610-40855632 GTTTAGGATGGTGGTGCTGGTGG + Intergenic
1189921964 X:45911175-45911197 CTTTATTATGGTTCTGTTGGGGG - Intergenic
1194618958 X:96144292-96144314 GGATAGTATAGTGGTGCTGGTGG + Intergenic
1202025193 Y:20514506-20514528 GTTTTATACTGTGCTGCTGGAGG - Intergenic