ID: 1025061526

View in Genome Browser
Species Human (GRCh38)
Location 7:55812800-55812822
Sequence TGTTTAGTATGGTGCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025061526_1025061532 2 Left 1025061526 7:55812800-55812822 CCCCAGCAGCACCATACTAAACA 0: 1
1: 0
2: 1
3: 18
4: 201
Right 1025061532 7:55812825-55812847 GAGAGAATCTGTGTGTTTTGGGG No data
1025061526_1025061531 1 Left 1025061526 7:55812800-55812822 CCCCAGCAGCACCATACTAAACA 0: 1
1: 0
2: 1
3: 18
4: 201
Right 1025061531 7:55812824-55812846 AGAGAGAATCTGTGTGTTTTGGG 0: 3
1: 4
2: 78
3: 191
4: 765
1025061526_1025061533 5 Left 1025061526 7:55812800-55812822 CCCCAGCAGCACCATACTAAACA 0: 1
1: 0
2: 1
3: 18
4: 201
Right 1025061533 7:55812828-55812850 AGAATCTGTGTGTTTTGGGGAGG 0: 1
1: 8
2: 51
3: 187
4: 717
1025061526_1025061536 25 Left 1025061526 7:55812800-55812822 CCCCAGCAGCACCATACTAAACA 0: 1
1: 0
2: 1
3: 18
4: 201
Right 1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG No data
1025061526_1025061535 24 Left 1025061526 7:55812800-55812822 CCCCAGCAGCACCATACTAAACA 0: 1
1: 0
2: 1
3: 18
4: 201
Right 1025061535 7:55812847-55812869 GAGGGAGAGTGAAGTGATTGTGG 0: 3
1: 23
2: 72
3: 185
4: 655
1025061526_1025061530 0 Left 1025061526 7:55812800-55812822 CCCCAGCAGCACCATACTAAACA 0: 1
1: 0
2: 1
3: 18
4: 201
Right 1025061530 7:55812823-55812845 GAGAGAGAATCTGTGTGTTTTGG No data
1025061526_1025061534 6 Left 1025061526 7:55812800-55812822 CCCCAGCAGCACCATACTAAACA 0: 1
1: 0
2: 1
3: 18
4: 201
Right 1025061534 7:55812829-55812851 GAATCTGTGTGTTTTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025061526 Original CRISPR TGTTTAGTATGGTGCTGCTG GGG (reversed) Intronic
900033781 1:390193-390215 TGTAAAGTCTGTTGCTGCTGGGG - Intergenic
900054616 1:620083-620105 TGTAAAGTCTGTTGCTGCTGGGG - Intergenic
900378475 1:2372026-2372048 TGTTATGAATAGTGCTGCTGTGG - Intronic
902711167 1:18240955-18240977 GGTTGAGTATGGGGCTTCTGTGG + Intronic
905105548 1:35561474-35561496 TGTGTGGTATGGTGCTTGTGTGG - Intronic
906748055 1:48235341-48235363 TGGTTAGTGGGTTGCTGCTGGGG - Intronic
909438482 1:75672021-75672043 TGGTCAGTTTGGTGTTGCTGTGG - Intergenic
911834614 1:102600857-102600879 TGTTTATTATGATTATGCTGGGG + Intergenic
912623915 1:111192352-111192374 TGTGTAGCATGGTGGTGCAGGGG - Intronic
916477902 1:165187170-165187192 TGACTATTCTGGTGCTGCTGTGG - Intergenic
917431279 1:174972193-174972215 TGATTAGTACTGTCCTGCTGAGG + Intronic
917912882 1:179669342-179669364 TGTTGAACAGGGTGCTGCTGTGG - Exonic
919147360 1:193652155-193652177 TGTTTAATTTGGTGTTCCTGTGG + Intergenic
920237907 1:204521349-204521371 TGTTAAGTCAGGTGCAGCTGAGG + Intronic
921774689 1:219083002-219083024 TGTTTAATTTGGTGTTCCTGTGG + Intergenic
922256138 1:223894349-223894371 TGTAAAGTCTGTTGCTGCTGGGG - Intergenic
923870926 1:237993511-237993533 TGTTTAATATAGTGCAGCTACGG + Intergenic
924337344 1:242997215-242997237 TGTAAAGTCTGTTGCTGCTGGGG - Intergenic
1063405198 10:5787649-5787671 TCTTAAGTATAGTGCTGATGTGG - Intronic
1064508201 10:16057311-16057333 TGCTTAGTGTGGTTCAGCTGAGG - Intergenic
1064614842 10:17142387-17142409 TGGTTTATCTGGTGCTGCTGGGG + Intronic
1065511243 10:26480310-26480332 TGTGTTGTGTGCTGCTGCTGGGG + Intronic
1066045636 10:31593250-31593272 TGTTTATTATGATGCATCTGTGG + Intergenic
1067066524 10:43106955-43106977 TGTTTAGCAGAGAGCTGCTGAGG - Intronic
1069652348 10:70058946-70058968 TGTTTACTATGGAACAGCTGAGG - Intronic
1073292975 10:102422403-102422425 TGTTCAGAATGGGGGTGCTGTGG - Intronic
1074057774 10:109938313-109938335 TGTCAACTTTGGTGCTGCTGAGG - Intergenic
1077160534 11:1110519-1110541 GGTTTAGGTTGGTGCTGCAGGGG + Intergenic
1077440194 11:2565020-2565042 TGTTGTGAATGTTGCTGCTGTGG + Intronic
1077552493 11:3207132-3207154 TGTTGAGGATGGTGATGGTGAGG + Intergenic
1080124974 11:28722323-28722345 TGTTTCTGATGCTGCTGCTGAGG - Intergenic
1080128441 11:28765699-28765721 TGTTCAGTTTGGTGTTCCTGTGG - Intergenic
1083551222 11:63591520-63591542 AGTTTAACAGGGTGCTGCTGTGG - Intronic
1085356513 11:75842911-75842933 GGTTTAGTTTGGTGATGGTGGGG + Intronic
1085648413 11:78244058-78244080 TGTTTTTGATGGTGCTTCTGAGG - Intronic
1085914431 11:80868266-80868288 TGTTTAGAATGGTTCTCCTGAGG + Intergenic
1088478466 11:110268472-110268494 TGTTTTCTATGGCACTGCTGGGG - Intronic
1089186468 11:116618825-116618847 TGGTTTATCTGGTGCTGCTGGGG - Intergenic
1091254692 11:134173220-134173242 TGTTCAGTAGGGGGCTGCTGAGG + Intronic
1091312204 11:134582588-134582610 TGGTGAGGATGTTGCTGCTGGGG - Intergenic
1091790160 12:3267627-3267649 TGTTTTGTTTTGTGCTTCTGGGG - Intronic
1092477169 12:8829168-8829190 TGTTCAGTTTGGTGTTACTGTGG + Intronic
1092664812 12:10784217-10784239 TGTTTTCTATGGAGCAGCTGTGG + Intergenic
1095163186 12:38940870-38940892 TGTTTAATTTGGTGTTTCTGCGG - Intergenic
1096160169 12:49369772-49369794 TGTTTAGTCTTATACTGCTGAGG + Intronic
1098483093 12:70988236-70988258 TGTTTAATATGTTGATGCTCTGG - Intergenic
1099710517 12:86218707-86218729 TGATTACTATGGAACTGCTGTGG + Intronic
1100173218 12:92001020-92001042 TATTGAGAATGGTGCTGCTGGGG - Intronic
1100875710 12:98959565-98959587 TGTTCAGTTTGGTGTTCCTGTGG - Intronic
1100909321 12:99339536-99339558 TGTTCAATATGGTGTTCCTGAGG + Intronic
1102463384 12:113113987-113114009 TCTTTATTACTGTGCTGCTGGGG - Intronic
1104042517 12:125139733-125139755 TGTTTACCATGGGGGTGCTGAGG + Intronic
1105297172 13:19097804-19097826 TGTTCCATATGGTGTTGCTGAGG - Intergenic
1105578364 13:21673322-21673344 TGTTTAGCTTCGTGCGGCTGCGG + Intronic
1106886716 13:34193369-34193391 AGGTTAGTTTAGTGCTGCTGTGG + Intergenic
1106932475 13:34681910-34681932 TGTGTGGTGTGGTGCTGCTGAGG + Intergenic
1108061885 13:46541453-46541475 TGTTTGATATGCTGTTGCTGTGG - Intergenic
1110063542 13:71071215-71071237 TGTTTAATTTGGTGTTCCTGAGG + Intergenic
1110383103 13:74877175-74877197 TGTTGAGTTTGATGCTCCTGTGG + Intergenic
1111291829 13:86181724-86181746 TGTTAAGTTTGGTGTTCCTGTGG - Intergenic
1111932158 13:94523685-94523707 TGATCAGAATGGTGCTGCTTAGG - Intergenic
1112657932 13:101473133-101473155 TGTTCAGTTTGGTGTTTCTGTGG - Intronic
1112952986 13:105025073-105025095 TGAATAGTATGGTTTTGCTGTGG - Intergenic
1114898572 14:27026431-27026453 TGTTTAATCTGGTGTTTCTGTGG + Intergenic
1123986641 15:25652298-25652320 TGTTTAGGGTGGTGGTGATGTGG + Intergenic
1125469253 15:39986503-39986525 TGTTTAGGATGTTGTTGCTCTGG - Intronic
1126425270 15:48520885-48520907 TGTGAAGTATGGAGCTGCTCGGG - Intronic
1126906212 15:53369064-53369086 TTTTCAGTATTGTGGTGCTGGGG + Intergenic
1130869585 15:87959973-87959995 TTTTTAGTAGGATGCAGCTGGGG - Intronic
1131018015 15:89073925-89073947 TGTTTCCGATGCTGCTGCTGTGG + Intergenic
1132669581 16:1097109-1097131 TCTTTAGCATGGGGGTGCTGAGG - Intergenic
1133110818 16:3547104-3547126 TGTTAGGAACGGTGCTGCTGTGG - Intronic
1133436870 16:5787255-5787277 TGTTTAGGATTGTGCTGCTTGGG + Intergenic
1134165507 16:11926311-11926333 TGGGTGGCATGGTGCTGCTGGGG - Intergenic
1134489801 16:14688136-14688158 TGGGTGGCATGGTGCTGCTGGGG + Intronic
1134495181 16:14727253-14727275 TGGGTGGCATGGTGCTGCTGGGG + Intronic
1134500567 16:14766373-14766395 TGGGTGGCATGGTGCTGCTGGGG + Intronic
1134527107 16:14952986-14953008 TGGGTGGCATGGTGCTGCTGGGG + Intergenic
1134545296 16:15103362-15103384 TGGGTGGCATGGTGCTGCTGGGG - Intronic
1134580016 16:15362677-15362699 TGGGTGGCATGGTGCTGCTGGGG - Intergenic
1134714692 16:16351519-16351541 TGGGTGGCATGGTGCTGCTGGGG + Intergenic
1134722569 16:16394883-16394905 TGGGTGGCATGGTGCTGCTGGGG + Intergenic
1134944859 16:18316986-18317008 TGGGTGGCATGGTGCTGCTGGGG - Intergenic
1134952123 16:18357139-18357161 TGGGTGGCATGGTGCTGCTGGGG - Intergenic
1135363411 16:21833629-21833651 TGGGTGGCATGGTGCTGCTGGGG - Intergenic
1136150047 16:28341550-28341572 TGGGTGGCATGGTGCTGCTGGGG - Intergenic
1136166282 16:28455365-28455387 TGGGTGGCATGGTGCTGCTGGGG - Intergenic
1136196691 16:28659667-28659689 TGGGTGGCATGGTGCTGCTGGGG + Intergenic
1136213031 16:28773792-28773814 TGGGTGGCATGGTGCTGCTGGGG + Intergenic
1136257757 16:29053705-29053727 TGGGTGGCATGGTGCTGCTGGGG + Intergenic
1136307210 16:29380355-29380377 TGGGTGGCATGGTGCTGCTGGGG - Intergenic
1136320735 16:29482598-29482620 TGGGTGGCATGGTGCTGCTGGGG - Intergenic
1136435308 16:30221938-30221960 TGGGTGGCATGGTGCTGCTGGGG - Intergenic
1138727084 16:59151777-59151799 TGTTTAAGATGGAGCTGCTGTGG + Intergenic
1139661283 16:68422612-68422634 TGTTTAGTTTGATGATGCTGAGG + Intronic
1140367459 16:74393047-74393069 TGGGTGGCATGGTGCTGCTGGGG + Intergenic
1140987377 16:80171251-80171273 TGGTGATTATGGTGGTGCTGTGG - Intergenic
1141023171 16:80517110-80517132 TGTTTTCTAGGATGCTGCTGAGG - Intergenic
1142107602 16:88314083-88314105 TGATTATGATGATGCTGCTGTGG + Intergenic
1144359007 17:14473490-14473512 TGTTCTGTATGATGCTGCAGTGG - Intergenic
1149781575 17:59400908-59400930 TTTTGAGTATGGAGCTGTTGCGG + Exonic
1153129105 18:1834337-1834359 TGTTAAATATGGTGTTCCTGTGG - Intergenic
1153411158 18:4794703-4794725 TGTCCAGAATGGTACTGCTGAGG - Intergenic
1153558824 18:6349243-6349265 TATTAAGAATGATGCTGCTGTGG - Intronic
1155792716 18:29995071-29995093 TGTTCAGTTTGGTGTTCCTGTGG - Intergenic
1156015148 18:32539042-32539064 TGTATAGTATGGAGGTTCTGGGG - Intergenic
1159728351 18:71992579-71992601 TGCTCAGTATGGTGCTGGGGTGG + Intergenic
1160590582 18:79942515-79942537 TGTTAAGTTTGGGGCTTCTGTGG - Intronic
1160820713 19:1056434-1056456 GGTTGAGTGTGGTGATGCTGTGG - Exonic
1160843465 19:1156556-1156578 TGTTGTGAGTGGTGCTGCTGTGG - Intronic
1166441573 19:42819871-42819893 TGTTGAGGATGGTGGTGGTGGGG + Intronic
1166517965 19:43461418-43461440 CCTTTATTATGGGGCTGCTGGGG + Exonic
1167325448 19:48821712-48821734 TGGTGAGTATGGTGGTGATGAGG + Intronic
925645445 2:6030928-6030950 TGTGGAGTAAGGTGCTGGTGAGG + Intergenic
928662858 2:33521167-33521189 TCTGTACCATGGTGCTGCTGAGG + Intronic
931467951 2:62508027-62508049 TGTTGTGTATAGTGCTGCTTTGG + Intronic
933773048 2:85755666-85755688 TTTTTAGTTTGGGGCTGGTGCGG + Intronic
933809051 2:86021145-86021167 TGTTTACTGTGGTCCAGCTGAGG + Exonic
936041262 2:109151421-109151443 TGTATTGGATGGTGCTGCTTTGG - Intronic
936437008 2:112516981-112517003 TGTTCAGAGTGTTGCTGCTGTGG + Intronic
937739344 2:125332429-125332451 TGTTTAATTTGGTGTTCCTGAGG - Intergenic
938319647 2:130354606-130354628 TGTTTAGGATGGTGGTGATAGGG - Intergenic
940289333 2:152063034-152063056 TCCTTAGTATGGAGCAGCTGAGG - Intronic
941746121 2:169088520-169088542 TGTTTAATTTGGTGTTCCTGTGG + Intronic
941756326 2:169190461-169190483 TGTTTATTGTGGTGGTCCTGAGG - Intronic
942849914 2:180472397-180472419 TCTTTAGAATGGTGCTGATGGGG - Intergenic
944518532 2:200538753-200538775 TTTTTAGTATGATGATGATGTGG + Intronic
947398245 2:229707555-229707577 GGTTTAGTGGGGTGCAGCTGTGG - Intronic
948228125 2:236328834-236328856 TGTTTATTTTATTGCTGCTGTGG + Intronic
948510173 2:238458726-238458748 TGTTTGGTAGGGTGAAGCTGTGG + Intergenic
948978248 2:241477525-241477547 TGTTACGAATAGTGCTGCTGTGG + Intronic
1169879961 20:10335885-10335907 TGTTTAGAATTGTGATTCTGAGG - Intergenic
1171021704 20:21590179-21590201 TGTTTAGAATTGTTCTGCTAGGG - Intergenic
1175053910 20:56180133-56180155 TATTTAGTATGGGGGTGTTGAGG - Intergenic
1179121718 21:38552712-38552734 TGTTCAGTACAGTGTTGCTGTGG - Intronic
1180621597 22:17166333-17166355 TCTCTAGTATGGGGCTGGTGGGG - Intergenic
1182239222 22:28901515-28901537 AGTTTAGTATGTGGCTGCTTTGG + Intronic
950604239 3:14064311-14064333 TGCTGAGGATGCTGCTGCTGAGG - Exonic
952633652 3:35501194-35501216 TGTTTTGTAAGCTGATGCTGGGG + Intergenic
952866269 3:37857265-37857287 TGTTTAGAATATTTCTGCTGAGG - Intergenic
952912859 3:38205301-38205323 TGTTCAGTTTGGTGTTTCTGTGG + Intronic
956627758 3:71283304-71283326 AGTTTAGAAGGGTGCTGCTGGGG - Intronic
962231891 3:133673427-133673449 TCTTAAGGATAGTGCTGCTGTGG - Intergenic
962465523 3:135654650-135654672 TGTTCAGGTTGGTGTTGCTGTGG - Intergenic
966755174 3:183362989-183363011 TCTTTAGTAAGGTGCTGTTTAGG - Intronic
968297114 3:197585074-197585096 TGTTTGGTCTGGAGGTGCTGGGG - Intergenic
971508449 4:27393219-27393241 TTTTTAGTCTTGTGCTGCTGGGG + Intergenic
974530902 4:63106958-63106980 TGTTAAGTTTGGTGTTCCTGTGG - Intergenic
974868082 4:67604390-67604412 TGTTTAATTTGGTGTTCCTGTGG + Intronic
975828131 4:78341023-78341045 TGTTTAGTATGATATTGCTGTGG + Intronic
979239789 4:118438093-118438115 TGTAAAGTCTGTTGCTGCTGGGG + Intergenic
979643812 4:123042505-123042527 GTTTTTGTATGGTGCTGCTATGG - Intronic
980175528 4:129339782-129339804 TGTTTGGTTTGGAGATGCTGGGG - Intergenic
980421519 4:132566469-132566491 TGTTTAGCAGGGAGCAGCTGAGG + Intergenic
981219917 4:142219939-142219961 TATTTTGTTTGGTGCAGCTGTGG - Intronic
988316427 5:29635352-29635374 TGTTTAGTCTAGTGCTGCGATGG + Intergenic
989942777 5:50173832-50173854 TGTTTGGTCTGTTGCTGGTGAGG + Intergenic
990911437 5:60856610-60856632 TTCTTAGTATGGTGACGCTGGGG + Intergenic
994973985 5:106779117-106779139 TGTTAAATTTGGTGTTGCTGTGG - Intergenic
995094142 5:108215146-108215168 TGTTGTGTATGTTGCTGCTATGG + Intronic
995995096 5:118288440-118288462 TGTTTAGTATGATGTTGCTGTGG + Intergenic
996434088 5:123415005-123415027 TATTTAACATGGTGCTGCTTAGG - Intronic
996596652 5:125210705-125210727 TGTTTGGTATGGTTAGGCTGAGG + Intergenic
997782044 5:136668406-136668428 TGTTTAGTTTAGTTCTGCTATGG - Intergenic
1001091692 5:168746612-168746634 TGTGTAGTATGGTGGTGTGGTGG + Intronic
1002440337 5:179261306-179261328 TGTTTAATATTTTGCTGCTCCGG - Intronic
1002740039 5:181428675-181428697 TGTAAAGTCTGTTGCTGCTGGGG + Intergenic
1007606733 6:43122918-43122940 TCTTTAGTGTGGTGCTGGTGTGG + Intronic
1008465461 6:51825450-51825472 GGTTTATTATGGGGCTGCTTGGG - Intronic
1010629825 6:78185545-78185567 TATTTAGTATGATGCTAGTGTGG + Intergenic
1012337164 6:98074846-98074868 TTTATAGTATGGTTTTGCTGTGG - Intergenic
1012345453 6:98179885-98179907 TGCTTGGTATGGTGCTGTTCTGG - Intergenic
1012485509 6:99717512-99717534 TGTTGAATATGGTGCTTATGTGG + Intergenic
1013165488 6:107587113-107587135 TCCTTAGCATAGTGCTGCTGGGG - Exonic
1014571025 6:123008048-123008070 TGTGTAGTACTGTTCTGCTGAGG + Intronic
1015501508 6:133938350-133938372 TCTTTAGTATGATTCTGCTTAGG + Intergenic
1017711547 6:157173307-157173329 TGTTGACTCTGGAGCTGCTGTGG + Intronic
1019245151 6:170704275-170704297 TGTAAAGTCTGTTGCTGCTGGGG + Intergenic
1019401379 7:855970-855992 TGCTCAGCGTGGTGCTGCTGCGG + Intronic
1020490272 7:8773986-8774008 TGTCTAGAATGGTGTTTCTGAGG + Intergenic
1020778733 7:12491578-12491600 TTTTTAGTGTGGTGTTTCTGAGG - Intergenic
1021211759 7:17862826-17862848 TATTTAATATGGTGTTCCTGTGG - Intronic
1023344257 7:39254870-39254892 TGTTGTGTACGCTGCTGCTGCGG - Intronic
1023899558 7:44465049-44465071 TGTTTGAACTGGTGCTGCTGAGG - Intronic
1024126003 7:46295137-46295159 TGTTAGATATGGTACTGCTGGGG - Intergenic
1024427582 7:49245246-49245268 TGTTTACAATGGGGCTGCTGAGG - Intergenic
1025061526 7:55812800-55812822 TGTTTAGTATGGTGCTGCTGGGG - Intronic
1028167315 7:87552630-87552652 TTTTTAGTATAGTGATGCTGTGG - Intronic
1028929693 7:96398635-96398657 TGTTTAATTTGGTGTTCCTGTGG + Intergenic
1034708729 7:153171357-153171379 TGTTTAGCAGGGAGCTGCTGGGG + Intergenic
1035502972 8:103927-103949 TGTAAAGTCTGTTGCTGCTGGGG - Intergenic
1036918926 8:12832944-12832966 TGTTTGGTATGGGGCTGCTTGGG + Intergenic
1038539193 8:28377577-28377599 TGTTGAGCAAGGTGCTCCTGGGG + Intronic
1039712037 8:40065126-40065148 TCTTCAGTATGATGTTGCTGTGG - Intergenic
1039819888 8:41126149-41126171 TGTTTAAGATGGAGTTGCTGTGG + Intergenic
1039877644 8:41601052-41601074 TATTTTGAATAGTGCTGCTGTGG + Intronic
1040966939 8:53092210-53092232 TGTTTAGTATAATGTTGCTGTGG + Intergenic
1042933275 8:74033669-74033691 TGTTTGGAAGGCTGCTGCTGTGG + Intergenic
1043079645 8:75750022-75750044 TGTTTTGTTTTGTGTTGCTGTGG - Intergenic
1044497352 8:92902597-92902619 TGTTCAGTTTGGTGTTCCTGTGG + Intronic
1045909193 8:107385741-107385763 TGTTCAGTACGATGTTGCTGTGG + Intronic
1046463507 8:114572003-114572025 TGTTCAGTCTGGTGTTCCTGTGG + Intergenic
1046502366 8:115095451-115095473 TGTTTAATATGGAGTTGCTCTGG - Intergenic
1046655375 8:116888213-116888235 TGTTTTGTTTTGGGCTGCTGTGG + Intergenic
1048136544 8:131751973-131751995 TGTTTTGTATGATCCTTCTGAGG - Intergenic
1049658433 8:143809074-143809096 TGTTTAGTAGGGTCTTCCTGTGG - Intronic
1049743462 8:144252132-144252154 TTTTTGGTTTGGGGCTGCTGGGG + Intronic
1051159968 9:14196487-14196509 TGTCCAGTGTGCTGCTGCTGGGG - Intronic
1051245801 9:15109532-15109554 TGTTCTGAATGGTACTGCTGTGG - Intergenic
1056278771 9:85019294-85019316 TGTGTAGCATGGTGGTGCTGGGG + Intronic
1056515182 9:87343282-87343304 TGGTTAGTGAGGTGCTGATGAGG - Intergenic
1059555628 9:115277349-115277371 TGTTTAGTTTGGTGTTCCTATGG + Intronic
1203605346 Un_KI270748v1:53483-53505 TGTAAAGTCTGTTGCTGCTGGGG + Intergenic
1185502273 X:607051-607073 TGTTTAATGAGCTGCTGCTGAGG - Intergenic
1188425122 X:30037312-30037334 TGTTCAATTTGGTGTTGCTGTGG + Intergenic
1190264106 X:48817325-48817347 GGTTCTGAATGGTGCTGCTGTGG + Exonic
1192005110 X:67202970-67202992 TGTTTGATATGGTTCTGATGTGG - Intergenic
1192284536 X:69721107-69721129 TGGTTTATCTGGTGCTGCTGGGG + Intronic
1198619677 X:138492190-138492212 TGTTTTGTTTGGTGCTGAAGAGG - Intergenic
1202387533 Y:24339923-24339945 TGTAAAGTCTGTTGCTGCTGGGG + Intergenic
1202483253 Y:25330205-25330227 TGTAAAGTCTGTTGCTGCTGGGG - Intergenic