ID: 1025061527

View in Genome Browser
Species Human (GRCh38)
Location 7:55812801-55812823
Sequence CTGTTTAGTATGGTGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025061527_1025061534 5 Left 1025061527 7:55812801-55812823 CCCAGCAGCACCATACTAAACAG 0: 1
1: 0
2: 2
3: 15
4: 114
Right 1025061534 7:55812829-55812851 GAATCTGTGTGTTTTGGGGAGGG No data
1025061527_1025061532 1 Left 1025061527 7:55812801-55812823 CCCAGCAGCACCATACTAAACAG 0: 1
1: 0
2: 2
3: 15
4: 114
Right 1025061532 7:55812825-55812847 GAGAGAATCTGTGTGTTTTGGGG No data
1025061527_1025061530 -1 Left 1025061527 7:55812801-55812823 CCCAGCAGCACCATACTAAACAG 0: 1
1: 0
2: 2
3: 15
4: 114
Right 1025061530 7:55812823-55812845 GAGAGAGAATCTGTGTGTTTTGG No data
1025061527_1025061533 4 Left 1025061527 7:55812801-55812823 CCCAGCAGCACCATACTAAACAG 0: 1
1: 0
2: 2
3: 15
4: 114
Right 1025061533 7:55812828-55812850 AGAATCTGTGTGTTTTGGGGAGG 0: 1
1: 8
2: 51
3: 187
4: 717
1025061527_1025061535 23 Left 1025061527 7:55812801-55812823 CCCAGCAGCACCATACTAAACAG 0: 1
1: 0
2: 2
3: 15
4: 114
Right 1025061535 7:55812847-55812869 GAGGGAGAGTGAAGTGATTGTGG 0: 3
1: 23
2: 72
3: 185
4: 655
1025061527_1025061531 0 Left 1025061527 7:55812801-55812823 CCCAGCAGCACCATACTAAACAG 0: 1
1: 0
2: 2
3: 15
4: 114
Right 1025061531 7:55812824-55812846 AGAGAGAATCTGTGTGTTTTGGG 0: 3
1: 4
2: 78
3: 191
4: 765
1025061527_1025061536 24 Left 1025061527 7:55812801-55812823 CCCAGCAGCACCATACTAAACAG 0: 1
1: 0
2: 2
3: 15
4: 114
Right 1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025061527 Original CRISPR CTGTTTAGTATGGTGCTGCT GGG (reversed) Intronic
900672244 1:3861852-3861874 CTGTTTAACATGGTACTGCAGGG + Intronic
900774020 1:4568131-4568153 CAGGTTACTATGGTGCTGTTTGG + Intergenic
902157328 1:14498976-14498998 CTGTTTACCATGCTGCTGCAGGG - Intergenic
905681148 1:39871797-39871819 CTGTTCAGTATGGTACTGTGGGG + Intronic
906187769 1:43874092-43874114 CTGTGTAATATGTTGCTGGTAGG + Intronic
909563116 1:77026570-77026592 CTGCATATTATGCTGCTGCTTGG - Intronic
909682132 1:78303593-78303615 TTGTTTGGCATGGTTCTGCTGGG + Intergenic
910195881 1:84639056-84639078 CTGTTTAGTTTGGATCAGCTGGG + Intergenic
910628658 1:89335340-89335362 TTGTTTAATTTGGTGTTGCTAGG - Intergenic
911324293 1:96451391-96451413 CTATTATGAATGGTGCTGCTAGG - Intergenic
913660435 1:121002121-121002143 CTCTTTGGTATGCTGCTGCCTGG - Intergenic
914011799 1:143785278-143785300 CTCTTTGGTATGCTGCTGCCTGG - Intergenic
914166034 1:145175856-145175878 CTCTTTGGTATGCTGCTGCCTGG + Intergenic
914650427 1:149693937-149693959 CTCTTTGGTATGCTGCTGCCTGG - Intergenic
915847246 1:159279342-159279364 CTGGTTATTGTGGTGCCGCTGGG - Intergenic
920208344 1:204309722-204309744 CAATTTAGTATGATGCTTCTTGG + Intronic
921141263 1:212309186-212309208 CTGTTTAATCTGGTGCTTGTTGG + Intronic
922815923 1:228449291-228449313 CTGTTTGATCTGGTGCTTCTTGG + Intergenic
924510272 1:244724249-244724271 CTGTGTCCTATGGTGATGCTAGG - Intergenic
1068694170 10:59948170-59948192 CTGTTGAGTATTGTGCTCCATGG + Intergenic
1071402078 10:85283249-85283271 CAGTTCAGCATGTTGCTGCTGGG + Intergenic
1073537197 10:104288292-104288314 CTGTTTTGAATGGTGCTGCAGGG + Intronic
1073756335 10:106584869-106584891 CTGTTTATTATGATGATGGTTGG - Intronic
1074212692 10:111351998-111352020 CTGTTTTCCATGGTGCAGCTAGG + Intergenic
1078249626 11:9606449-9606471 CTGTTTAATCTGGTGCTTGTTGG - Intergenic
1080082976 11:28243233-28243255 CTGCTTGGAATAGTGCTGCTGGG - Intronic
1080103500 11:28486540-28486562 CTGTTTAGCCTGATGCTGCCAGG + Intergenic
1080798065 11:35583898-35583920 CTTTTTAGGGTGGTGCTGCATGG + Intergenic
1093220345 12:16413405-16413427 CTGTTCACAATGGGGCTGCTTGG - Intronic
1093978222 12:25447198-25447220 TTGTTAAGTGTGGTGCTGCAAGG + Intronic
1100173219 12:92001021-92001043 CTATTGAGAATGGTGCTGCTGGG - Intronic
1103007115 12:117430179-117430201 CTTTTTCCTATGGTGCTGCAAGG - Intronic
1103892855 12:124253068-124253090 CTGCTGTGAATGGTGCTGCTTGG - Intronic
1118426359 14:65667828-65667850 CTGTTTGGTATGGTGATACATGG - Intronic
1119431666 14:74572156-74572178 CTGTGTTGTATGAGGCTGCTTGG - Intronic
1122823041 14:104356605-104356627 CTGTTTACCCTGGAGCTGCTGGG - Intergenic
1126425271 15:48520886-48520908 GTGTGAAGTATGGAGCTGCTCGG - Intronic
1130135530 15:81178767-81178789 CTGTGTAGTATGGTGGTGTTTGG + Intronic
1133185240 16:4091516-4091538 CTATTGTGGATGGTGCTGCTGGG - Intronic
1133436869 16:5787254-5787276 CTGTTTAGGATTGTGCTGCTTGG + Intergenic
1133772716 16:8876985-8877007 CTGTTGTGAATGGTGCTGCGGGG + Intergenic
1137772462 16:51027509-51027531 TTGTTTATTACAGTGCTGCTGGG - Intergenic
1144571960 17:16405943-16405965 ATGTTAATTATGGTGCTGCCGGG + Intergenic
1145937390 17:28722824-28722846 CTGTTTAATCTGGTGCTTGTTGG - Exonic
1148764552 17:50029473-50029495 CTGTCTGGTCTGGGGCTGCTGGG - Intergenic
1149957633 17:61070181-61070203 CTGTTTAATCTGGTGCTTGTTGG - Intronic
1158581760 18:58690357-58690379 CAGATCAGTATGGTGCCGCTAGG + Intronic
1158901257 18:61963859-61963881 ATGTTTAGTTTGGTGCTGTCTGG + Intergenic
1159610049 18:70514672-70514694 CTGTATTGAATGATGCTGCTAGG - Intergenic
1160153523 18:76413393-76413415 CTGTTGGGTGTGGTGCTGCTAGG - Intronic
1166441572 19:42819870-42819892 CTGTTGAGGATGGTGGTGGTGGG + Intronic
1167165203 19:47794573-47794595 CTGTTTGATCTGGTGCTCCTTGG + Intergenic
1168415221 19:56163455-56163477 CTGTTCCTCATGGTGCTGCTTGG + Intergenic
1168439491 19:56351664-56351686 CTTTTTGGTCTGGTGCTGATAGG - Intronic
931178499 2:59876609-59876631 CTGCTAAATATGGTTCTGCTTGG + Intergenic
931927986 2:67096032-67096054 CAGATTAGAAAGGTGCTGCTAGG - Intergenic
932306746 2:70709221-70709243 CTGGTAAGTGTGGTGCTGGTTGG - Intronic
932698557 2:73977440-73977462 CAGTTTAGTCTGGAGCTGGTAGG + Intergenic
933906786 2:86902025-86902047 CTGATTGGTTTTGTGCTGCTGGG + Intergenic
934024690 2:87991609-87991631 CTGATTGGTTTTGTGCTGCTGGG - Intergenic
934936341 2:98468620-98468642 CTGTTTAGTGTGTGGCTGGTGGG + Intronic
935775762 2:106469686-106469708 CTGATTGGTTTTGTGCTGCTGGG - Intergenic
936365378 2:111849646-111849668 CTGATTGGTTTTGTGCTGCTGGG - Intronic
937459616 2:122074625-122074647 CTGCTTAGCCTGCTGCTGCTAGG - Intergenic
938262277 2:129904633-129904655 CTGTTTATGATGGTGCAACTTGG - Intergenic
938319648 2:130354607-130354629 TTGTTTAGGATGGTGGTGATAGG - Intergenic
938565616 2:132515795-132515817 CTGTTTAGTCTGATTCTTCTTGG - Intronic
942849915 2:180472398-180472420 GTCTTTAGAATGGTGCTGATGGG - Intergenic
945087275 2:206145043-206145065 GTGTTTACTATGGTGCTTTTGGG + Intronic
1169242081 20:3991131-3991153 ATCTTTAGTATTTTGCTGCTAGG + Intronic
1169660823 20:7976481-7976503 CTGTTTAACATGTGGCTGCTGGG - Intergenic
1171021705 20:21590180-21590202 CTGTTTAGAATTGTTCTGCTAGG - Intergenic
1173609835 20:44358908-44358930 CTCTTTGGTGTGGTGATGCTGGG + Intronic
1174523900 20:51156127-51156149 CTGTTGTGAATAGTGCTGCTAGG + Intergenic
1176686449 21:9852323-9852345 TTGATTAATATGGTGCTGCTGGG + Intergenic
1177225795 21:18253839-18253861 TTTTTTAGTGTGTTGCTGCTGGG + Intronic
1177932935 21:27307499-27307521 CTGCTTAGTATTATGCAGCTAGG - Intergenic
1181666314 22:24400503-24400525 CTTTTTTGAATAGTGCTGCTGGG + Intronic
1181911447 22:26241504-26241526 CTGTTTAATATGCTGGGGCTTGG - Intronic
951897978 3:27628790-27628812 ATGTTTATTGGGGTGCTGCTTGG + Intergenic
952378435 3:32785956-32785978 CTGTTTAATCTGGTGCTTGTTGG - Intergenic
952633651 3:35501193-35501215 CTGTTTTGTAAGCTGATGCTGGG + Intergenic
956627759 3:71283305-71283327 CAGTTTAGAAGGGTGCTGCTGGG - Intronic
961002336 3:123382477-123382499 CTGTTGTGAATAGTGCTGCTGGG - Intronic
963090401 3:141478320-141478342 CTGCTAAATTTGGTGCTGCTTGG + Intergenic
964881570 3:161429265-161429287 CTGTTTAATCTGGTGCTTGTTGG + Intergenic
964972583 3:162579580-162579602 CTGTTTAGAGTGGGGCTTCTGGG + Intergenic
965481844 3:169228253-169228275 CTGTTTAGTATAGTATTGCCCGG - Intronic
967823581 3:193860801-193860823 CTATTTTGAATGGTGCTGCTGGG - Intergenic
968698105 4:2042415-2042437 CTGCTGAGTCTGGCGCTGCTGGG + Exonic
970878661 4:20902436-20902458 CTGGCTGGTATGGTGCTGCCAGG - Intronic
971497404 4:27281539-27281561 CTGGGTAGTATTGTGCTGCATGG - Intergenic
971508448 4:27393218-27393240 TTTTTTAGTCTTGTGCTGCTGGG + Intergenic
980349898 4:131670792-131670814 TTGATTAATGTGGTGCTGCTGGG + Intergenic
983941755 4:173540411-173540433 CTGTTTAGTATAAAACTGCTAGG + Intergenic
984634019 4:182091826-182091848 CTATTTTGTTTGGTGATGCTAGG - Intergenic
988373776 5:30407033-30407055 CTTTATAGTATGGTGATGGTAGG + Intergenic
988997927 5:36732115-36732137 CTGTTCAGGATGGGGGTGCTTGG - Intergenic
989497056 5:42121846-42121868 CCGTTTAGTATGGTGAATCTGGG + Intergenic
990166227 5:52996231-52996253 CTGTTACTTATGGTGCTGCATGG + Intronic
995791111 5:115888221-115888243 CTGTTTACTATGATACTTCTAGG + Intronic
996292694 5:121872193-121872215 CTGTGTACTATGGTGCAGATGGG - Intergenic
996487999 5:124059219-124059241 CCTGTTAGTATGGAGCTGCTTGG - Intergenic
997441719 5:133913258-133913280 CAGTTCAGTATGTTCCTGCTTGG - Intergenic
997853912 5:137356407-137356429 CTGCTTACTAAGGTGATGCTGGG - Intronic
1005353674 6:24961427-24961449 CAGTGTAATATGGTGCTCCTTGG + Intronic
1006914230 6:37584497-37584519 CTGTTCAGTGTGGAGCTGCTGGG - Intergenic
1007235052 6:40384830-40384852 CTGTTTAGTTTGGGGGTTCTGGG - Intergenic
1008465462 6:51825451-51825473 GGGTTTATTATGGGGCTGCTTGG - Intronic
1012159935 6:95871994-95872016 CTTTTTGGTATAATGCTGCTGGG - Intergenic
1022671171 7:32457736-32457758 ATGTCCAATATGGTGCTGCTTGG - Intergenic
1025061527 7:55812801-55812823 CTGTTTAGTATGGTGCTGCTGGG - Intronic
1026362517 7:69615666-69615688 TTGTTTAGTATGGTGTACCTGGG + Intronic
1030075896 7:105736325-105736347 CTGTTCATTATCGTGCTGCAAGG - Intronic
1031997920 7:128245096-128245118 CTGTTTAGTAGGGACCTCCTGGG - Intronic
1032574571 7:133039692-133039714 CTGCTTTGTAGGCTGCTGCTCGG - Intronic
1034708728 7:153171356-153171378 CTGTTTAGCAGGGAGCTGCTGGG + Intergenic
1036591316 8:10171194-10171216 CTGGTTAGAATGCTGCTGGTTGG + Intronic
1036918925 8:12832943-12832965 CTGTTTGGTATGGGGCTGCTTGG + Intergenic
1038539192 8:28377576-28377598 CTGTTGAGCAAGGTGCTCCTGGG + Intronic
1043035254 8:75189517-75189539 CTTTTTAGTATGGTGCTATTTGG - Intergenic
1043540044 8:81251569-81251591 CTATTGTGAATGGTGCTGCTAGG - Intergenic
1053782871 9:41629269-41629291 TTGATTAATATGGTGCTGCTGGG - Intergenic
1054170822 9:61839409-61839431 TTGATTAATATGGTGCTGCTGGG - Intergenic
1054666714 9:67741398-67741420 TTGATTAATATGGTGCTGCTGGG + Intergenic
1055156872 9:73073737-73073759 CTGTTATGAATAGTGCTGCTTGG + Intronic
1056278770 9:85019293-85019315 CTGTGTAGCATGGTGGTGCTGGG + Intronic
1060373702 9:123099248-123099270 CCATTGAGTGTGGTGCTGCTTGG + Intronic
1062212017 9:135370274-135370296 GTGTTTATTATGAAGCTGCTTGG - Intergenic
1187642556 X:21310952-21310974 CAGTGTAGCATGGTGCTGATAGG - Intergenic
1196613522 X:117741646-117741668 CTATTGTGAATGGTGCTGCTAGG - Intergenic
1196964221 X:121038229-121038251 CTCTTTAGTATGGTGGGCCTGGG + Intergenic