ID: 1025061528

View in Genome Browser
Species Human (GRCh38)
Location 7:55812802-55812824
Sequence TCTGTTTAGTATGGTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025061528_1025061530 -2 Left 1025061528 7:55812802-55812824 CCAGCAGCACCATACTAAACAGA 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1025061530 7:55812823-55812845 GAGAGAGAATCTGTGTGTTTTGG No data
1025061528_1025061532 0 Left 1025061528 7:55812802-55812824 CCAGCAGCACCATACTAAACAGA 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1025061532 7:55812825-55812847 GAGAGAATCTGTGTGTTTTGGGG No data
1025061528_1025061535 22 Left 1025061528 7:55812802-55812824 CCAGCAGCACCATACTAAACAGA 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1025061535 7:55812847-55812869 GAGGGAGAGTGAAGTGATTGTGG 0: 3
1: 23
2: 72
3: 185
4: 655
1025061528_1025061533 3 Left 1025061528 7:55812802-55812824 CCAGCAGCACCATACTAAACAGA 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1025061533 7:55812828-55812850 AGAATCTGTGTGTTTTGGGGAGG 0: 1
1: 8
2: 51
3: 187
4: 717
1025061528_1025061531 -1 Left 1025061528 7:55812802-55812824 CCAGCAGCACCATACTAAACAGA 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1025061531 7:55812824-55812846 AGAGAGAATCTGTGTGTTTTGGG 0: 3
1: 4
2: 78
3: 191
4: 765
1025061528_1025061534 4 Left 1025061528 7:55812802-55812824 CCAGCAGCACCATACTAAACAGA 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1025061534 7:55812829-55812851 GAATCTGTGTGTTTTGGGGAGGG No data
1025061528_1025061536 23 Left 1025061528 7:55812802-55812824 CCAGCAGCACCATACTAAACAGA 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025061528 Original CRISPR TCTGTTTAGTATGGTGCTGC TGG (reversed) Intronic
900672243 1:3861851-3861873 TCTGTTTAACATGGTACTGCAGG + Intronic
902157329 1:14498977-14498999 ACTGTTTACCATGCTGCTGCAGG - Intergenic
902669806 1:17965239-17965261 GCTGTTTAGTGTGGTCCTGGTGG + Intergenic
905681147 1:39871796-39871818 ACTGTTCAGTATGGTACTGTGGG + Intronic
913551620 1:119922360-119922382 TCTGTTTATTATTCTGCTGGGGG - Exonic
915675655 1:157527580-157527602 TCTTTTTATTTTTGTGCTGCTGG + Intronic
916433372 1:164753946-164753968 TCTGTTTAGTGTGGTGGAGAAGG + Intronic
916909287 1:169328074-169328096 TCTGATAAGTCTGCTGCTGCTGG + Intronic
921342980 1:214153185-214153207 TGTGTTTAGTATAGTGCACCTGG - Intergenic
921676677 1:217983885-217983907 TCTGTTGAGCTTGGTGCTGGAGG + Intergenic
924632493 1:245753865-245753887 TCTGTTTTATATGCTACTGCAGG - Intronic
1072933208 10:99686065-99686087 TCTGTTTAGAATGCTGGTTCTGG + Intronic
1073537196 10:104288291-104288313 ACTGTTTTGAATGGTGCTGCAGG + Intronic
1076090151 10:127678641-127678663 TGTTTTTAGTATGGTTCTGTTGG - Intergenic
1077451623 11:2651820-2651842 TCTGTCTGGTATGGTCCTGTGGG - Intronic
1080082977 11:28243234-28243256 TCTGCTTGGAATAGTGCTGCTGG - Intronic
1081409162 11:42735431-42735453 TCTGTTAAGTTTTGTGATGCAGG - Intergenic
1082098991 11:48156349-48156371 TCTGTTTATTACGTTGCTGCTGG + Intronic
1091131346 11:133149677-133149699 GCAGTTGAGGATGGTGCTGCTGG + Intronic
1098724536 12:73946178-73946200 TCTGTTTATTCTGATACTGCTGG + Intergenic
1099593665 12:84628771-84628793 TCTGTTTTGTTTGGTGCTATAGG - Intergenic
1100173220 12:92001022-92001044 GCTATTGAGAATGGTGCTGCTGG - Intronic
1107079395 13:36358047-36358069 TCTGTTTAGTATTGTGTTCCTGG - Intronic
1107428569 13:40317989-40318011 TTGGTTTAGTAGGCTGCTGCAGG + Intergenic
1108043723 13:46363272-46363294 TCTATTTAGTTGGGTGTTGCAGG - Intronic
1110740338 13:78988553-78988575 TCTTTTCTGAATGGTGCTGCAGG - Intergenic
1112380852 13:98888223-98888245 TCTGTTTTGTTTATTGCTGCAGG - Exonic
1112542045 13:100323614-100323636 TCTGTTAAGAATGGAGCTCCTGG - Intronic
1115702305 14:35965922-35965944 TCTGTTTAGTTTTGTACTTCAGG + Intergenic
1120967888 14:90183741-90183763 TCTGTTGAGTATGGTTGTTCAGG + Intronic
1121400056 14:93668122-93668144 TCTATTTATCATGGTGCTGGAGG + Intronic
1122334539 14:100961887-100961909 TCTGTTTAGAATTCTACTGCAGG + Intergenic
1122823042 14:104356606-104356628 TCTGTTTACCCTGGAGCTGCTGG - Intergenic
1124203339 15:27697114-27697136 TCTGTGTTGTTGGGTGCTGCAGG - Intergenic
1128799425 15:70488163-70488185 TCTGTCTTTTATGGTGCTCCAGG - Intergenic
1128870737 15:71153466-71153488 TCTCTGTAATATGGTGTTGCAGG - Intronic
1130156133 15:81351655-81351677 TCTCTTTTCTAGGGTGCTGCAGG + Intronic
1133772715 16:8876984-8877006 GCTGTTGTGAATGGTGCTGCGGG + Intergenic
1136080511 16:27849486-27849508 TTTGTTTAGGCTGGTGTTGCTGG + Intronic
1137772463 16:51027510-51027532 TTTGTTTATTACAGTGCTGCTGG - Intergenic
1140042505 16:71417891-71417913 TATATGTAGTAGGGTGCTGCAGG + Intergenic
1140192105 16:72826696-72826718 TCTCTTTACTATTGTGCAGCTGG + Intronic
1144571959 17:16405942-16405964 TATGTTAATTATGGTGCTGCCGG + Intergenic
1144864156 17:18324123-18324145 TCTGTTTAGTCAGCTGGTGCAGG + Intergenic
1146508244 17:33424008-33424030 TCTATTCAGTTTGATGCTGCTGG + Intronic
1148764553 17:50029474-50029496 TCTGTCTGGTCTGGGGCTGCTGG - Intergenic
1149388702 17:56168755-56168777 TCTTTTTAGCATGATGATGCTGG + Intronic
1149735959 17:58993693-58993715 TCTGTATAGTATTGTGGTGGCGG + Intronic
1151879271 17:76885408-76885430 TCTGTTGAGGATATTGCTGCAGG + Intronic
1152370549 17:79885836-79885858 TCTGTTGAGCATGGTACTGGGGG - Intergenic
1158975790 18:62710306-62710328 TCTGTTTACTTTGGTGAGGCAGG + Intergenic
1164102600 19:22070818-22070840 TCTATGTAATATGATGCTGCAGG - Intronic
926798411 2:16637991-16638013 TCTGCTAAGTGTGGTGCTGAGGG + Intronic
930369927 2:50489422-50489444 TCTTTTCAGTGTGTTGCTGCAGG + Intronic
931925015 2:67062944-67062966 CCTGTTAAGTAAGGTCCTGCTGG - Intergenic
935740163 2:106140308-106140330 TCTGTTTAATTTGGAGCTGTTGG - Intronic
940980994 2:160004047-160004069 ACTGTTTGGTATGATCCTGCTGG - Intronic
942090582 2:172486218-172486240 TCTGTCCACTATGGGGCTGCTGG + Intronic
942849916 2:180472399-180472421 TGTCTTTAGAATGGTGCTGATGG - Intergenic
946577927 2:221096454-221096476 TGTGTTTAGTTTGGGACTGCCGG + Intergenic
947301205 2:228690065-228690087 TCTCATTAAGATGGTGCTGCGGG - Intergenic
1171021827 20:21591524-21591546 TCTGTTCAGTATGGTGGTGGTGG + Intergenic
1172482990 20:35282287-35282309 TCTGTTAGGAATAGTGCTGCTGG - Intronic
1172781274 20:37438241-37438263 TCTGTTTACAAAGGTGCTGAGGG + Intergenic
1173312003 20:41904985-41905007 TCTGGTTAGGATGATGCTGCTGG + Intergenic
1173690097 20:44954004-44954026 TCGGTTTCACATGGTGCTGCAGG - Intronic
1176686448 21:9852322-9852344 TTTGATTAATATGGTGCTGCTGG + Intergenic
1176948581 21:15015997-15016019 GCTATTTAGTAGGGTGCTGCTGG - Intronic
1177831322 21:26142326-26142348 TCTGCTAAGAATGTTGCTGCTGG + Intronic
1178241408 21:30905516-30905538 TCTGTTAAAGGTGGTGCTGCAGG - Intergenic
1184309640 22:43632976-43632998 TCTGTTAAGTAAGATGCTGAGGG + Intronic
953118190 3:40013510-40013532 TCTTTCCAGTATGTTGCTGCTGG - Intronic
956627760 3:71283306-71283328 TCAGTTTAGAAGGGTGCTGCTGG - Intronic
957571411 3:81951296-81951318 GCAGTTTAGTATGGCCCTGCTGG + Intergenic
959307587 3:104688908-104688930 TTTGTTTAGTATGATTCAGCAGG + Intergenic
965463790 3:169002176-169002198 TCTGTTTATTTTGGTGCCGTGGG - Intergenic
967823582 3:193860802-193860824 ACTATTTTGAATGGTGCTGCTGG - Intergenic
969644119 4:8416608-8416630 TCTGATTTGTAAGGTGTTGCGGG - Intronic
972094068 4:35326426-35326448 TCTGCTTGATATGCTGCTGCAGG + Intergenic
973234296 4:47881990-47882012 TCTGTGTTGTATGGTTCTGTGGG - Intronic
974746029 4:66077378-66077400 TCTGTTCAGTATTGTGCTGAAGG + Intergenic
977982011 4:103335529-103335551 TTTGTTTATTATGGTTCTGGAGG + Intergenic
980349897 4:131670791-131670813 TTTGATTAATGTGGTGCTGCTGG + Intergenic
980614423 4:135200183-135200205 TCTGTTTAGCTTGGTTCTGGTGG + Intergenic
987005335 5:13704373-13704395 GCTGTCTAGTGTAGTGCTGCTGG + Intronic
991140654 5:63237666-63237688 TCTATTCAGTATTGTGCTGGAGG + Intergenic
991327110 5:65446394-65446416 ACTGTTTGCTTTGGTGCTGCTGG - Intronic
991424384 5:66475744-66475766 TCTCTTTGGTATGGAGATGCAGG - Intergenic
992288969 5:75265227-75265249 TCTGTCTAGTTTCGTGCTGTGGG + Intergenic
996292695 5:121872194-121872216 TCTGTGTACTATGGTGCAGATGG - Intergenic
997440814 5:133907492-133907514 TCTGTTTAGCATGCTGCTAGGGG - Intergenic
997853913 5:137356408-137356430 TCTGCTTACTAAGGTGATGCTGG - Intronic
998276831 5:140762580-140762602 ACTGTTTAATATGGTACTGTAGG - Intergenic
998498437 5:142611305-142611327 TCTATTTACTAGGGTTCTGCAGG - Intronic
1000190850 5:158909246-158909268 TCAGGTTAGGATGGTGGTGCTGG + Intronic
1002991489 6:2243216-2243238 TCTGCTGAGTGTGGTGCTTCAGG + Intronic
1006914231 6:37584498-37584520 CCTGTTCAGTGTGGAGCTGCTGG - Intergenic
1011045080 6:83072864-83072886 TCTGTTCAGAATGATGCAGCTGG + Intronic
1012104601 6:95140174-95140196 ACTTTTTAGTATTGTTCTGCAGG + Intergenic
1012159936 6:95871995-95872017 TCTTTTTGGTATAATGCTGCTGG - Intergenic
1012591815 6:100991146-100991168 TCTCTTTAGTATAGGTCTGCTGG + Intergenic
1013570820 6:111423681-111423703 TCTGTTTAGGAGGCTGCTGGAGG + Intronic
1014823418 6:126019208-126019230 TCTTTTTAGTATGGTGCTTTGGG + Intronic
1015800371 6:137054914-137054936 TCTGTTTAGTATTGTACTGGAGG + Intergenic
1017625189 6:156340812-156340834 TCTCTTCAGTATGTTGCTCCTGG - Intergenic
1017705145 6:157115389-157115411 TTGATTTAGTATTGTGCTGCTGG + Intronic
1018591286 6:165425653-165425675 TCTTTTCAGTATTGTGCTGTAGG + Intronic
1019654299 7:2180918-2180940 TCTGTTCAGCATTGTGCTGGAGG - Intronic
1024534234 7:50416875-50416897 TCTGTTTTGTAGGTTGCTACTGG - Intergenic
1025061528 7:55812802-55812824 TCTGTTTAGTATGGTGCTGCTGG - Intronic
1026362516 7:69615665-69615687 TTTGTTTAGTATGGTGTACCTGG + Intronic
1030972126 7:116072931-116072953 TCTGTTTAACATTGTGCTGGAGG + Intronic
1031997921 7:128245097-128245119 TCTGTTTAGTAGGGACCTCCTGG - Intronic
1034708727 7:153171355-153171377 CCTGTTTAGCAGGGAGCTGCTGG + Intergenic
1045708133 8:104951008-104951030 TCTCATTAGTAAGGTGCTTCCGG - Intronic
1046124922 8:109893700-109893722 TCTTTTAAGTTTGGAGCTGCTGG - Intergenic
1048007551 8:130431667-130431689 CATGTTTAGTGTGGTCCTGCAGG - Intronic
1052622924 9:30937100-30937122 TTTGATTGGTATGATGCTGCGGG - Intergenic
1053749792 9:41240902-41240924 TTTGGTTACTGTGGTGCTGCAGG + Intergenic
1053782872 9:41629270-41629292 TTTGATTAATATGGTGCTGCTGG - Intergenic
1054170823 9:61839410-61839432 TTTGATTAATATGGTGCTGCTGG - Intergenic
1054255297 9:62805238-62805260 TTTGGTTACTATGGTGCTGTAGG + Intergenic
1054336012 9:63810369-63810391 TTTGGTTACTATGGTGCTGTAGG - Intergenic
1054666713 9:67741397-67741419 TTTGATTAATATGGTGCTGCTGG + Intergenic
1056066726 9:82943232-82943254 TCTGTTTATAATGGTGCTAATGG - Intergenic
1056278769 9:85019292-85019314 ACTGTGTAGCATGGTGGTGCTGG + Intronic
1186236945 X:7522567-7522589 TGTATTTTGAATGGTGCTGCAGG - Intergenic
1188927420 X:36061809-36061831 TCTGTTTTTTATGGTGATGGGGG + Intronic
1193478654 X:81998391-81998413 TCCATTCAGTATGGTGCTGTGGG + Intergenic
1196964220 X:121038228-121038250 TCTCTTTAGTATGGTGGGCCTGG + Intergenic
1197512813 X:127391958-127391980 TCTGTTTACTATGGTACTTATGG - Intergenic