ID: 1025061529

View in Genome Browser
Species Human (GRCh38)
Location 7:55812811-55812833
Sequence GATTCTCTCTCTGTTTAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025061529_1025061533 -6 Left 1025061529 7:55812811-55812833 CCATACTAAACAGAGAGAGAATC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1025061533 7:55812828-55812850 AGAATCTGTGTGTTTTGGGGAGG 0: 1
1: 8
2: 51
3: 187
4: 717
1025061529_1025061534 -5 Left 1025061529 7:55812811-55812833 CCATACTAAACAGAGAGAGAATC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1025061534 7:55812829-55812851 GAATCTGTGTGTTTTGGGGAGGG No data
1025061529_1025061532 -9 Left 1025061529 7:55812811-55812833 CCATACTAAACAGAGAGAGAATC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1025061532 7:55812825-55812847 GAGAGAATCTGTGTGTTTTGGGG No data
1025061529_1025061537 26 Left 1025061529 7:55812811-55812833 CCATACTAAACAGAGAGAGAATC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1025061537 7:55812860-55812882 GTGATTGTGGGACTTTGCATTGG 0: 51
1: 124
2: 161
3: 185
4: 251
1025061529_1025061535 13 Left 1025061529 7:55812811-55812833 CCATACTAAACAGAGAGAGAATC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1025061535 7:55812847-55812869 GAGGGAGAGTGAAGTGATTGTGG 0: 3
1: 23
2: 72
3: 185
4: 655
1025061529_1025061531 -10 Left 1025061529 7:55812811-55812833 CCATACTAAACAGAGAGAGAATC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1025061531 7:55812824-55812846 AGAGAGAATCTGTGTGTTTTGGG 0: 3
1: 4
2: 78
3: 191
4: 765
1025061529_1025061536 14 Left 1025061529 7:55812811-55812833 CCATACTAAACAGAGAGAGAATC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025061529 Original CRISPR GATTCTCTCTCTGTTTAGTA TGG (reversed) Intronic
903181517 1:21607376-21607398 GTTTCTTTATCTGTTGAGTAGGG - Intronic
903509348 1:23862726-23862748 GATTCTCACTCTGTAAAGTGGGG - Intronic
904395472 1:30218395-30218417 GAATCTCTCTGTGTTTATTTAGG + Intergenic
905725881 1:40251697-40251719 GACTAGCTCTCTATTTAGTAGGG + Intergenic
905905720 1:41617078-41617100 GATCCTGTCTCTGTTTGGAAAGG - Intronic
907621127 1:55981981-55982003 GACTTCCTCACTGTTTAGTAAGG + Intergenic
909288840 1:73856137-73856159 TATTATCTCTCTGTTTCGGAGGG - Intergenic
912628245 1:111223935-111223957 GATTCTCCATCTCTTTGGTATGG - Intronic
917541960 1:175922943-175922965 GCCTCTCTCTCTGTGTAGTCTGG + Intergenic
918654813 1:187011313-187011335 GATTCTCTTTCTGGTTTGAAAGG - Intergenic
920871085 1:209795547-209795569 GATTCTCACTCTTTTTAGCTAGG - Intronic
923191406 1:231624125-231624147 GTTTCTCTCTCTCTTTAGGCAGG + Intronic
1063282646 10:4647569-4647591 GATACTCACTATGTTTAGAAGGG - Intergenic
1064036244 10:11915716-11915738 CATTCTCTCTCTGCTTGGCAAGG + Intergenic
1066690587 10:38023583-38023605 GATCCTCTCAATGTCTAGTATGG - Intronic
1067700088 10:48565212-48565234 GTTTCTCTCTCTGTTAAATGGGG + Intronic
1072992497 10:100210523-100210545 GTTTCTTTCTCTGTTTAAAATGG - Intronic
1074771633 10:116738775-116738797 CATCCTCTCTTTGTTTAGCAAGG - Intronic
1078410384 11:11110379-11110401 TATTCTCTATCTGTATAATAAGG + Intergenic
1078459312 11:11501439-11501461 TATTCACTCTCTGTTTATTAAGG + Intronic
1079676081 11:23228644-23228666 CATTCTCTGACAGTTTAGTAGGG + Intergenic
1080975896 11:37339990-37340012 CATTCTGCCTCTATTTAGTAAGG + Intergenic
1081859232 11:46322940-46322962 GGTGCTCTCTCTATTTAGGAAGG - Intergenic
1082741455 11:56916220-56916242 TATTATCTCTCTATTCAGTACGG + Intergenic
1084330421 11:68426731-68426753 GATTGTCTCTCAGTTCTGTAAGG + Intronic
1085642482 11:78201053-78201075 GCTTCTCTGTCAGTGTAGTATGG + Intronic
1086215884 11:84380283-84380305 CATTCTCTAGCTGATTAGTAGGG - Intronic
1087656540 11:100929949-100929971 GATTATTTATCTGTTAAGTATGG + Intronic
1088020726 11:105115275-105115297 GTTTCTCTCTCATTTCAGTAGGG - Intergenic
1089336355 11:117726512-117726534 GATGCTGTCTCTGTTTGGAAAGG + Intronic
1090210498 11:124917603-124917625 GATTCTCTCTCTGTTCCATGCGG + Intergenic
1092200803 12:6581519-6581541 AATTCCCTCTCAGTTTAGGAGGG - Intronic
1092520962 12:9272304-9272326 GCTTCTCTCACAGTTTTGTAAGG + Intergenic
1092521514 12:9278639-9278661 TATTCTCTATCAGTTTAATATGG + Intergenic
1098417845 12:70256763-70256785 GTTTTTCTCTCTGATTATTAAGG + Intronic
1107139319 13:36980259-36980281 GAGTCTCTCTCTGTTGACCAAGG + Intronic
1107494440 13:40911470-40911492 CATGCTCTCTCTATTTAGTCTGG - Intergenic
1108310842 13:49188925-49188947 ATTTCTATCTCTGCTTAGTATGG - Intronic
1108668707 13:52659494-52659516 CATGCTCTCTCTGTTTAGTCTGG + Intronic
1111530834 13:89536149-89536171 AATTCTTTCTCTGTTCATTATGG + Intergenic
1112481335 13:99778475-99778497 GATTGACTCTCTGTGAAGTATGG + Intronic
1112964206 13:105166973-105166995 GCATCTCTCTCTGATTATTAAGG + Intergenic
1112978588 13:105352824-105352846 GATTCTCCCTCTGTCTGGTTTGG - Intergenic
1115154030 14:30317836-30317858 GATTCTATCTCTGTGTAGAGAGG - Intergenic
1118978443 14:70697086-70697108 GATTCTCCCTCCGTACAGTAAGG + Intergenic
1119460033 14:74794077-74794099 CCTCCTCTCTCTGTTTATTATGG + Intronic
1121038544 14:90726639-90726661 GGTTCTTTATCTGTGTAGTAGGG - Intronic
1126973738 15:54150089-54150111 ATTTCTCTCTCTTTTTACTATGG + Intronic
1127215881 15:56822646-56822668 GACTCTGTCTCTGTTTAGTGGGG + Intronic
1128186480 15:65647172-65647194 GATTCTCTCTCTTTTAAGACTGG - Intronic
1128231624 15:66039521-66039543 GTTTCTCTGTCTGTAAAGTAGGG - Intronic
1129999416 15:80034226-80034248 TAGTCTCTCTCTGTTCAGTGGGG + Intergenic
1131767296 15:95692389-95692411 TATTTACTCTCTTTTTAGTAGGG - Intergenic
1133278693 16:4652894-4652916 TTTTCTCCCTCTGGTTAGTAAGG - Intronic
1134623670 16:15708838-15708860 GATTCTCTCTCTGTTTCAGAGGG - Intronic
1135241813 16:20813890-20813912 GATTCTCTTTTTTTTTTGTAGGG - Intronic
1137629190 16:49930362-49930384 GCTTCTCTCCCTGTTCTGTAGGG - Intergenic
1137781945 16:51104773-51104795 GATGCTCTTTCTGTTTAAAAAGG + Intergenic
1138005094 16:53326991-53327013 GATTCTCTTTCTATATAATAAGG + Exonic
1139919885 16:70452951-70452973 GATGCTCTATATGTTCAGTAGGG - Intergenic
1142933188 17:3306000-3306022 GATCCTATCTCTGTTAAGCAAGG + Intergenic
1143421426 17:6795929-6795951 TATTCTCTTTCTGTTAAATATGG + Intronic
1151471458 17:74320837-74320859 AATTCTTTCTATTTTTAGTAGGG - Intergenic
1151898602 17:76996953-76996975 GATTCTCTCTCTGGTCTGCAAGG + Intergenic
1153107111 18:1540816-1540838 AATTCACTCTCTGTTAAATATGG - Intergenic
1154171271 18:12053073-12053095 GATTCTGCCTCTTTTTAGCAGGG - Intergenic
1154509602 18:15082607-15082629 GTTTCTCTCTCTGCCTAGGATGG - Intergenic
1155869523 18:31008661-31008683 GATCCACTCTCTGTTTAGCAAGG - Intronic
1158060555 18:53335612-53335634 GATTCTCTCTTGGTATAGTTTGG - Intronic
1160351345 18:78182802-78182824 GATCCTCTCTCTGTTTATGTGGG - Intergenic
1160626831 18:80214928-80214950 GATTCTCTCTCTCTTTTTTTTGG - Intronic
1162786184 19:13036417-13036439 GATTCCCTCTCTGTCTCGTCCGG - Intronic
1162872407 19:13596293-13596315 GTTTCTCTCTCTTTTTATTGTGG - Intronic
1164737420 19:30552056-30552078 AATTCACTCTCTTTTTAGCATGG + Intronic
1168412834 19:56150470-56150492 GTTACTCTCTCTTTTTAATAAGG + Intronic
925964227 2:9048579-9048601 GAATATCTCTTTGTATAGTATGG + Intergenic
926516248 2:13850608-13850630 GATTCTCTCTCTGAGTAGCGTGG - Intergenic
929084991 2:38159316-38159338 GGTTTTCTTTCTGTTTAGTAAGG + Intergenic
929620487 2:43349311-43349333 GAGTCTCTCTGTGTTTAGAGTGG - Intronic
929999975 2:46854698-46854720 CATTCTGTCTCTTTTTAGCATGG + Intronic
930220116 2:48737866-48737888 GATTCTTTCTCTGTAAAGTGAGG - Intronic
930557076 2:52910853-52910875 TATTCTCTCTTTGTTTTGTGGGG - Intergenic
933315502 2:80709671-80709693 GAGTACCTCTCTGTTTAGAAAGG - Intergenic
933460200 2:82573594-82573616 GATTCCCTCTCTGTGTGGTGAGG + Intergenic
933521180 2:83376239-83376261 TATTCTCTCTCCTTCTAGTATGG + Intergenic
935328630 2:101960459-101960481 GTTTCTCTCTCTGTCAAGTGAGG - Intergenic
935387861 2:102520082-102520104 TATTTTCTCTCTGCTTAGTTTGG + Intronic
937761200 2:125605113-125605135 AATTGTCTCACTGTTCAGTATGG - Intergenic
942712454 2:178851978-178852000 GAGTCTCCGTCTGTTTGGTAGGG - Intronic
942717025 2:178904710-178904732 CATTCTCTCTCTGTTTCTCAAGG + Intronic
944977991 2:205079413-205079435 GATTCTCTCTGTTTTCAGTATGG + Intronic
945502124 2:210589240-210589262 CACTTCCTCTCTGTTTAGTATGG + Intronic
945506572 2:210648782-210648804 GCTACCCTCTCTGTTTGGTAAGG - Intronic
948117643 2:235505469-235505491 TATACTCACTTTGTTTAGTAGGG + Intronic
1169592487 20:7160521-7160543 GTTATTCTCTCTGTTTAGTATGG + Intergenic
1169945206 20:10980775-10980797 AATTCTCTCTCTGCTTTGCAAGG + Intergenic
1171108681 20:22460342-22460364 GAGTCTCTCTCTGGTGGGTAGGG - Intergenic
1172181717 20:33007805-33007827 GCTTCTCTATCTGTTCAGTGGGG + Intronic
1174219845 20:48945552-48945574 GGTTATCTCTCTTTTTAGAATGG + Intronic
1175872248 20:62214023-62214045 GATTCTCTCCCTGGGTAGGAAGG + Intergenic
1176788467 21:13289167-13289189 GTTTCTCTCTCTGCCTAGGATGG + Intergenic
1177295146 21:19163596-19163618 GATTCTCTGCCTGTGTCGTATGG + Intergenic
1177630760 21:23724669-23724691 GATTCTCTCTCAGTTTGTTTGGG + Intergenic
1177987622 21:27997372-27997394 GTTTCTCTCTCTGCCTAGGATGG + Intergenic
1178176284 21:30103455-30103477 AATTCTCTCTCAGGTTTGTAAGG - Intergenic
1184707438 22:46224283-46224305 GATACCCTCTCTGCTTAGTCTGG + Intronic
950579014 3:13850714-13850736 ACTTCTCTCTCTGTACAGTAAGG + Intronic
951255042 3:20439013-20439035 GATTCTCTCTCTGTACTGCATGG - Intergenic
952249530 3:31637896-31637918 AATTTTATCTCTGTTTAATAAGG + Intergenic
953405175 3:42656402-42656424 GTTTCTCCATCTGTGTAGTAGGG + Intronic
954330136 3:49885464-49885486 GACTCTCACTCTGATTAGCAGGG + Intergenic
956014400 3:64866334-64866356 TAGTCTCCCTCTGTTTAGCATGG - Intergenic
958677191 3:97280248-97280270 CCTTCTCTCTCTGTAAAGTAAGG + Intronic
959291674 3:104482969-104482991 TGTTCTCTCTCTGTTTCCTAGGG + Intergenic
964954918 3:162341932-162341954 CAGTTTTTCTCTGTTTAGTATGG + Intergenic
965700005 3:171451022-171451044 GAAAGCCTCTCTGTTTAGTAGGG + Intronic
971759760 4:30750278-30750300 TCTTTTCTCTCTTTTTAGTATGG + Intronic
974224366 4:59019264-59019286 GATTCTCTCTGTGTGTCTTATGG + Intergenic
974761201 4:66276599-66276621 GATTCTCCCTCAGTGTAGAAAGG + Intergenic
975057351 4:69950923-69950945 CATTCTCTCACAGTTTAGGAAGG + Intergenic
975406535 4:73996946-73996968 CATTCTTTATCTTTTTAGTATGG - Exonic
978444111 4:108764226-108764248 TATTCTCTCTGTGTTTTGAAAGG + Intergenic
979200606 4:117973518-117973540 AATTCTTTCTGTGTTTAGCAAGG + Intergenic
980985020 4:139686545-139686567 GATTCTTTCTCTGTTGAATAGGG - Intronic
983560408 4:169095852-169095874 GATTCCCTCTCTTTCTAGTTTGG - Exonic
983676345 4:170298418-170298440 TCTTCTCTCTCTTTTTAGTCTGG - Intergenic
984430882 4:179647462-179647484 CATTTTTTCTCTGATTAGTAAGG - Intergenic
987639209 5:20589930-20589952 GACTTTGTCTCTGTTTAGTGGGG - Intergenic
988912124 5:35853906-35853928 GAGTCTCACTATGTTTACTAGGG + Intronic
993169589 5:84401007-84401029 GATTATCTCTCTCTGTTGTATGG + Intergenic
993765309 5:91849131-91849153 GCTTATGTCTCTGTTAAGTATGG + Intergenic
994039599 5:95244031-95244053 GATACTCTCTCTGTCTTTTAAGG - Intronic
999683329 5:154080333-154080355 GATTCTCTATCTATTGAGTAAGG + Intronic
1000823402 5:166013503-166013525 GATTCTCTTTCTTTTTTGTGCGG + Intergenic
1000939649 5:167344993-167345015 GATTCTCTCTCTGCCTTCTAAGG - Intronic
1001729092 5:173935713-173935735 GATTTTCTTTCTGTTTATTGAGG - Intronic
1003523721 6:6881289-6881311 GCCTCTCTCTTTTTTTAGTAGGG - Intergenic
1005646350 6:27842408-27842430 TATTCTCTGTATGTTTAATAAGG - Intronic
1006592211 6:35166680-35166702 GATTGTCTCTCTGTGCAGGAAGG + Intergenic
1007558532 6:42786086-42786108 GGTTCTTTCTCATTTTAGTAAGG - Intronic
1011018853 6:82788569-82788591 GATTCTCTCTCTGTGTCATGAGG - Intergenic
1012862766 6:104580479-104580501 ATTTCTCTCTCTTTTTAGTTTGG - Intergenic
1012958354 6:105594941-105594963 AACATTCTCTCTGTTTAGTAAGG + Intergenic
1013734022 6:113204934-113204956 CATTGCCTCTCTGTGTAGTAGGG + Intergenic
1015443814 6:133280431-133280453 GAGTCTTGCTCTGTTGAGTACGG + Intronic
1015822887 6:137281986-137282008 GATTTTCCCTCTATTTAGCATGG + Intergenic
1016627728 6:146191889-146191911 GTTTCTCTCTGTGTTTAAAAGGG + Intronic
1022282667 7:28926887-28926909 GATGCTCTTTCTGTTTAACATGG + Intergenic
1025061529 7:55812811-55812833 GATTCTCTCTCTGTTTAGTATGG - Intronic
1026063738 7:67050053-67050075 GATTTTCACCTTGTTTAGTAAGG - Exonic
1026714608 7:72777407-72777429 GATTTTCACCTTGTTTAGTAAGG + Exonic
1028310670 7:89329931-89329953 GTTTTTCTTTCTGTTTGGTAAGG + Intronic
1028766519 7:94565682-94565704 GATTCACATTCTGCTTAGTAAGG + Intergenic
1029845635 7:103409610-103409632 TATTTTCTCTGTGTTTGGTAAGG + Intronic
1030956719 7:115861892-115861914 TATATTCTCTCTGTTAAGTAAGG + Intergenic
1031546395 7:123055045-123055067 GATTCTCTCTCTGTGTCATGTGG + Intergenic
1031785518 7:126026582-126026604 TCATCTCTCTCTGTTGAGTAGGG + Intergenic
1031797314 7:126191525-126191547 TACCCTCTCTCTGTTTAGAAAGG - Intergenic
1033765918 7:144490131-144490153 GATTCTCTCTTTTTTTTGGAAGG - Intronic
1038272539 8:26087268-26087290 GTTTCTCCCTCTTTTTAGAACGG + Intergenic
1038958357 8:32491590-32491612 GATTCTCTCCCTGGGTAGTCTGG + Intronic
1041170286 8:55134878-55134900 TATTCTCTGTCTGCTTATTAGGG - Intronic
1043026586 8:75078087-75078109 GATTTTCTCTCTCTTTATTCTGG + Intergenic
1045562657 8:103280689-103280711 GAATCTCTCTCTGTTGCCTAGGG - Intergenic
1045717844 8:105069486-105069508 GACTCACGCTCTGTTTTGTAGGG - Intronic
1046389611 8:113552722-113552744 TATTTTCTCTCTGCTTAGTTGGG - Intergenic
1046760245 8:118012914-118012936 GATTCTTTCTATCGTTAGTAAGG + Intronic
1048789744 8:138089460-138089482 AATTTCCTCACTGTTTAGTAAGG - Intergenic
1051064739 9:13089110-13089132 GATTTTTTCTCTGTTTACTCAGG + Intergenic
1051525761 9:18042579-18042601 TATTCTGCCTCTGTTTAGTCAGG + Intergenic
1055131932 9:72785680-72785702 AATTCTCCCTTTGTTTAGTGTGG - Intronic
1055251254 9:74309003-74309025 ATTTCTATCTCTGTTTATTAAGG - Intergenic
1056085128 9:83140554-83140576 GATTCTCTCACTGTCCACTAAGG - Intergenic
1056292546 9:85158279-85158301 AAATCTCTCTCTGTTAAATATGG - Intergenic
1056726797 9:89126362-89126384 GAGTCTCTCTCTGCTAAGAATGG + Intronic
1057476964 9:95411323-95411345 AATTCTCTCTCTGCTCAGAAGGG + Intergenic
1058255283 9:102754210-102754232 GATTTTTTGTATGTTTAGTAGGG - Intergenic
1186139310 X:6554254-6554276 GGTTGCCTCTCTGTTTGGTAAGG + Intergenic
1186727572 X:12373633-12373655 GCTTCTTTCTTTGTTTAGTTGGG - Intronic
1186824790 X:13328780-13328802 GATTGTGTCTCTGGTTAGTTAGG - Intergenic
1187579428 X:20592543-20592565 GATTCTCTCTCTGTGCAGCAAGG + Intergenic
1188992353 X:36837585-36837607 GATTCTCTCTCTGTGCTGCACGG + Intergenic
1189131336 X:38500956-38500978 GATTCTCTCTGTGTTTTGGAAGG + Intronic
1191171970 X:57457481-57457503 GATTTTCTCTCTTTTTATTTGGG - Intronic
1191953757 X:66622435-66622457 CATGCTCTCTCTATGTAGTATGG + Intronic
1192340083 X:70257169-70257191 GCGTCTCTCTCTGTAGAGTAGGG - Intergenic
1196046515 X:111261533-111261555 GATTTTCTCTCACTTTAGAAGGG + Intronic
1196411567 X:115425290-115425312 GAATGTCTCTCTGTTGACTATGG - Intergenic
1196432011 X:115637036-115637058 GATTTTCTCTCTGTTAAGCTGGG - Intronic
1201677752 Y:16606077-16606099 GAATGTCTTTCTGTTTATTATGG - Intergenic
1201772723 Y:17632092-17632114 GATTTTTTCTCTGTTTATTGAGG + Intergenic
1201828832 Y:18273895-18273917 GATTTTTTCTCTGTTTATTGAGG - Intergenic
1201898400 Y:19019156-19019178 GTTTCTGTGTCTGTTTATTATGG - Intergenic