ID: 1025061536

View in Genome Browser
Species Human (GRCh38)
Location 7:55812848-55812870
Sequence AGGGAGAGTGAAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025061527_1025061536 24 Left 1025061527 7:55812801-55812823 CCCAGCAGCACCATACTAAACAG 0: 1
1: 0
2: 2
3: 15
4: 114
Right 1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG No data
1025061529_1025061536 14 Left 1025061529 7:55812811-55812833 CCATACTAAACAGAGAGAGAATC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG No data
1025061528_1025061536 23 Left 1025061528 7:55812802-55812824 CCAGCAGCACCATACTAAACAGA 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG No data
1025061525_1025061536 26 Left 1025061525 7:55812799-55812821 CCCCCAGCAGCACCATACTAAAC 0: 1
1: 0
2: 3
3: 14
4: 125
Right 1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG No data
1025061526_1025061536 25 Left 1025061526 7:55812800-55812822 CCCCAGCAGCACCATACTAAACA 0: 1
1: 0
2: 1
3: 18
4: 201
Right 1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025061536 Original CRISPR AGGGAGAGTGAAGTGATTGT GGG Intronic
No off target data available for this crispr