ID: 1025062370

View in Genome Browser
Species Human (GRCh38)
Location 7:55821399-55821421
Sequence CAAGGTAAAATCTCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025062370_1025062376 1 Left 1025062370 7:55821399-55821421 CCTGCCTCAGAGATTTTACCTTG 0: 1
1: 0
2: 0
3: 25
4: 225
Right 1025062376 7:55821423-55821445 AGGAGAAACAGGCCATGAAATGG 0: 1
1: 0
2: 2
3: 41
4: 452
1025062370_1025062374 -10 Left 1025062370 7:55821399-55821421 CCTGCCTCAGAGATTTTACCTTG 0: 1
1: 0
2: 0
3: 25
4: 225
Right 1025062374 7:55821412-55821434 TTTTACCTTGGAGGAGAAACAGG 0: 1
1: 0
2: 4
3: 36
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025062370 Original CRISPR CAAGGTAAAATCTCTGAGGC AGG (reversed) Intronic
904810629 1:33161375-33161397 CAAAGTAAAATTGCAGAGGCAGG - Intronic
907529633 1:55081674-55081696 AATGGGAAAAACTCTGAGGCTGG + Intronic
907791279 1:57667096-57667118 CAATGCAAAAACTCTAAGGCAGG - Intronic
907888447 1:58615654-58615676 AAATGTAAAATCTCTGAGTCTGG - Intergenic
908349410 1:63269920-63269942 TAAAGTAAAATCTTTGAAGCTGG + Intergenic
909355486 1:74704071-74704093 CAAGTTAAAATCTGTAGGGCAGG - Intergenic
909939656 1:81596404-81596426 CAATGTAAAATCTCTGGAGAAGG - Intronic
912982308 1:114386711-114386733 CCAGGTAAAATCTCTAAACCAGG + Intergenic
913067123 1:115266463-115266485 GAATGTAAATTCTCTCAGGCAGG - Intergenic
917473584 1:175348372-175348394 CAAGTTAAAATTTTTGAGGGGGG + Intronic
917861129 1:179145682-179145704 CAATGCAAAAACTCTGAGGTAGG + Intronic
917895367 1:179482139-179482161 CCAGGCAAAATCTCTGAGCTAGG + Intronic
918298464 1:183180490-183180512 CTGGGTAAATTCTCTGAGGCTGG - Intergenic
918371533 1:183866533-183866555 CACGGGAAAGCCTCTGAGGCAGG + Intronic
919197785 1:194311191-194311213 CTAGGTGAAAACTTTGAGGCAGG - Intergenic
919883418 1:201915754-201915776 CAAGGGAACATCTGTGAGGATGG - Intronic
920399559 1:205668652-205668674 CCAGGTGAACGCTCTGAGGCTGG - Intronic
921567541 1:216738125-216738147 CCAGTGAAAATCTCTGAGGGTGG + Intronic
1063432261 10:6000613-6000635 CATGGAAGAATCTCTGAGACAGG - Intergenic
1063907732 10:10798307-10798329 AAAAGCAAAATCTCCGAGGCAGG + Intergenic
1064561178 10:16596619-16596641 AGAGGAAAGATCTCTGAGGCTGG - Intronic
1066504447 10:36026912-36026934 CAAGTCTAAATCCCTGAGGCAGG + Intergenic
1066631863 10:37466012-37466034 CAATGCAAAATCTCTTAGGGTGG - Intergenic
1067462297 10:46466670-46466692 CACGGCAAAAGCCCTGAGGCTGG + Intergenic
1067624900 10:47917967-47917989 CACGGCAAAAGCCCTGAGGCTGG - Intergenic
1067934441 10:50597058-50597080 CAAGGTCAAAGCACTGAGCCAGG - Intronic
1068696300 10:59971364-59971386 AAAAGCAAAATTTCTGAGGCAGG - Intergenic
1070256033 10:74813769-74813791 CAAGGTGAATTCTTTGAGGAAGG + Intergenic
1072146439 10:92643799-92643821 CAATTAAAAATTTCTGAGGCGGG - Intronic
1072884209 10:99259664-99259686 CTAGGTAAACACTCTAAGGCAGG + Intergenic
1073649206 10:105340960-105340982 CAAGGTCAACCCTCAGAGGCTGG + Intergenic
1074049017 10:109865975-109865997 GATGGCAAAAGCTCTGAGGCAGG + Intronic
1074763790 10:116686224-116686246 AAAGGTGAAACCTCTGAGCCTGG + Intronic
1076093927 10:127714760-127714782 CAAGGGATCATCTCTGAGCCAGG + Intergenic
1077563182 11:3278718-3278740 TGAGGTAGAATTTCTGAGGCCGG + Intergenic
1077569075 11:3324534-3324556 TGAGGTAGAATTTCTGAGGCCGG + Intergenic
1079079601 11:17405109-17405131 CAAGGTAAACTCCCTGAGGTAGG + Intronic
1079898903 11:26156183-26156205 GAAGCTAAAATCTAGGAGGCAGG - Intergenic
1081117076 11:39216920-39216942 GAAGTTCAACTCTCTGAGGCAGG + Intergenic
1081718782 11:45271012-45271034 GATGGTAAACTCTCTGAGGGTGG - Intronic
1081752454 11:45521509-45521531 CAAAGCAAAAGCTCAGAGGCAGG + Intergenic
1084084217 11:66847496-66847518 CAAGGTCCCTTCTCTGAGGCTGG + Intergenic
1085163208 11:74368356-74368378 AAAGTTAAAAACACTGAGGCTGG - Intronic
1085553038 11:77393247-77393269 CAAGGTAGAATTTCAGAGGAGGG - Intronic
1085595847 11:77808827-77808849 AAAGGTATAATATTTGAGGCCGG - Intronic
1086332363 11:85766702-85766724 GAATCTAAACTCTCTGAGGCAGG - Intronic
1087384561 11:97453957-97453979 CAAGCAAATATCTATGAGGCAGG - Intergenic
1089908230 11:122067725-122067747 CAATGTAAAATCTCTTAGTGTGG + Intergenic
1090005121 11:122995544-122995566 CAAAGTAAAATCTTCTAGGCTGG - Intergenic
1090123814 11:124063861-124063883 CTAGGCATAATCTCTGAGGCAGG + Intergenic
1092374207 12:7941950-7941972 TAAAGTAAAAACTATGAGGCAGG - Intergenic
1092462664 12:8699482-8699504 AAATGTTAAATCTCTGAGACCGG - Intronic
1097668052 12:62504035-62504057 GAAGATAAACTCTATGAGGCAGG + Intronic
1098272537 12:68782908-68782930 CAAGGAAAGAAGTCTGAGGCAGG + Intronic
1099459305 12:82903065-82903087 GAAGGTAAAAGCTCTGCGGCAGG - Intronic
1101743573 12:107520807-107520829 GAAGGTAAGAGCTCTGAAGCTGG + Intronic
1102685674 12:114722695-114722717 CAAGTTAAAATCTCTAAGCCTGG - Intergenic
1103294727 12:119876754-119876776 CAAGCCAAAAGCACTGAGGCAGG + Intronic
1105543623 13:21336452-21336474 CATGGAAAAATCTCTAAGGCAGG + Intergenic
1105932327 13:25064236-25064258 CAAGGAAAAGTCTCTGAGCAAGG + Intergenic
1106183944 13:27391961-27391983 CAATGGAATAACTCTGAGGCAGG + Intergenic
1110212372 13:72988738-72988760 CAAGTGAAATTATCTGAGGCTGG + Intronic
1111516571 13:89340312-89340334 AAACGTAAAATGTCTAAGGCTGG - Intergenic
1111827913 13:93291820-93291842 CAAGTTAAAATCTCTCTGGATGG - Intronic
1112199355 13:97260219-97260241 CGAGGTCAAAGCTCTAAGGCAGG + Intronic
1112938649 13:104832435-104832457 CAAGGGAAAATGTCTCAGGCAGG + Intergenic
1113478241 13:110600704-110600726 GAGGGTAAAAGCTCTGGGGCTGG - Intergenic
1115062310 14:29207994-29208016 AGAGGGAAAAACTCTGAGGCAGG - Intergenic
1115601756 14:34961959-34961981 AAAAATAAAAACTCTGAGGCTGG - Intergenic
1116010962 14:39351681-39351703 GAAGGTTCCATCTCTGAGGCAGG + Intronic
1116816500 14:49588823-49588845 TAAGATAAAAGCTCTTAGGCCGG - Intronic
1118035068 14:61857703-61857725 AAGGGAAAAATCTCTGATGCAGG + Intergenic
1119898367 14:78239605-78239627 CAATGTAAAAGAACTGAGGCTGG - Intergenic
1121881812 14:97507671-97507693 CAAGTTCAAATCTCTAGGGCAGG - Intergenic
1122539072 14:102486792-102486814 AAAGGTAAATTCTCAGAGCCAGG - Intronic
1124545430 15:30622054-30622076 TAATGTTAGATCTCTGAGGCTGG - Intergenic
1124778949 15:32611454-32611476 TAATGTTAGATCTCTGAGGCTGG - Intergenic
1125031276 15:35078467-35078489 CAAGGAAAAATCAGTGAGGAAGG + Intergenic
1126579618 15:50230971-50230993 CAAGTCAAAATCTCTGGGGTGGG + Intronic
1127825136 15:62696334-62696356 GAAGGTAAAAAGTCTGAGGGTGG - Intronic
1128094864 15:64946612-64946634 TCAGGTAGAATCTCTGAGGTAGG + Intronic
1134009097 16:10838121-10838143 CGAGGTACATTCTGTGAGGCTGG - Intergenic
1134369590 16:13610672-13610694 GAAACTAAAATATCTGAGGCAGG - Intergenic
1135167321 16:20150883-20150905 CAAGGGAAAGTCTCTGTAGCAGG - Intergenic
1136532386 16:30878227-30878249 CAATGTAAAATGTCTGGGGTGGG + Intronic
1137398065 16:48131151-48131173 GAAGGGAAAAGGTCTGAGGCAGG + Intronic
1137474104 16:48791864-48791886 GAAGGTCAGATGTCTGAGGCAGG + Intergenic
1137498911 16:48995579-48995601 CCAGGGAAAAGCTCTGATGCAGG + Intergenic
1138963244 16:62052180-62052202 CAAAGGAATATATCTGAGGCTGG - Intergenic
1139860998 16:70021155-70021177 CAAGGTACTATCTATGAGGACGG + Intergenic
1141055436 16:80809628-80809650 CAAGGGCAAAGCCCTGAGGCTGG + Intergenic
1141260874 16:82452661-82452683 CAAGGTACATTCTCTGAGTCTGG + Intergenic
1142896604 17:2983320-2983342 AAAGGTTCAATCTCAGAGGCTGG - Intronic
1143332433 17:6147611-6147633 TAAGGTGAGTTCTCTGAGGCTGG - Intergenic
1145859456 17:28196271-28196293 AAAGGTACAATCTCAGAGGTTGG + Exonic
1146132090 17:30286795-30286817 CAAGGTACAATATATGAAGCAGG - Exonic
1148439815 17:47706093-47706115 GCAGGTGAAATCTCTGAGGCGGG + Intronic
1149629423 17:58110116-58110138 CAAGGGATAATCTCTGGGACTGG - Intergenic
1153059881 18:984008-984030 CCATGAGAAATCTCTGAGGCAGG - Intergenic
1153214406 18:2805902-2805924 CAGGCAAAAATCTCTGAGCCAGG - Intergenic
1153450362 18:5220338-5220360 CAAAGCAAAATCCATGAGGCAGG + Intergenic
1153694210 18:7624092-7624114 AAATGTAAAATCCCAGAGGCAGG - Intronic
1154153909 18:11928908-11928930 CAAGGTAAAATCCCTGGAGAAGG + Intergenic
1157406541 18:47426591-47426613 CAAGTTCAAATGTCTGAAGCTGG - Intergenic
1166780542 19:45340479-45340501 CAAGGAAAAGGCTCTGGGGCAGG + Intronic
1167795968 19:51708894-51708916 AAAGGGAAAAGCCCTGAGGCAGG + Intergenic
1167868038 19:52344194-52344216 CCAGATGAAGTCTCTGAGGCAGG - Intronic
928104689 2:28461172-28461194 AAATGTAAAGTCCCTGAGGCAGG + Intronic
928924947 2:36567985-36568007 AAAGATAAAACCTCAGAGGCAGG + Intronic
929343160 2:40847804-40847826 AAAAATAAAATCTTTGAGGCTGG - Intergenic
929513237 2:42582352-42582374 AAAGGTAAAATATCTCGGGCTGG - Intronic
930327698 2:49941127-49941149 CAAGGTAAATTCCATGAAGCAGG - Intronic
931175964 2:59855709-59855731 CCAGGTAAAATGTCTGAAACTGG + Intergenic
931242101 2:60462450-60462472 CAATGTTTAATCACTGAGGCGGG + Intronic
932738644 2:74274630-74274652 AAAGATAAAATTTCTGAGCCTGG - Intronic
937262675 2:120596446-120596468 CTGGGTCAAATCTTTGAGGCTGG + Intergenic
937860339 2:126703285-126703307 CAGGGTAAAATTTCTGACTCAGG - Intergenic
937884542 2:126890823-126890845 TAAGGTACCATCTTTGAGGCTGG + Intergenic
938249452 2:129802784-129802806 CAGGCAAAAATCTCTGAGCCAGG - Intergenic
939588583 2:144034879-144034901 CAAGGTTTAGTCTCTCAGGCAGG + Intronic
940408711 2:153335524-153335546 CAAGATCAAATCTCTAGGGCAGG - Intergenic
941876200 2:170435958-170435980 CAAGGAAAATCCTCTGAAGCAGG + Intronic
942978491 2:182049030-182049052 TATGATTAAATCTCTGAGGCAGG + Intronic
944731024 2:202517644-202517666 AAAGATAAAATAACTGAGGCCGG - Intronic
944780513 2:203012710-203012732 CATGTGAAAATCCCTGAGGCTGG + Intronic
945660891 2:212683960-212683982 CAAGGCAAACACCCTGAGGCAGG + Intergenic
945929202 2:215838309-215838331 CAAAGGAAAATCTCTATGGCTGG + Intergenic
946399757 2:219462054-219462076 CAAGGTCAGACCCCTGAGGCTGG + Exonic
946590605 2:221243260-221243282 CACTATAAAATCTCTGAGGGTGG + Intergenic
946900960 2:224370789-224370811 CAAGTTAAAATCCCTGCTGCAGG - Intergenic
948462222 2:238135471-238135493 CGAGTTAAAATCTGTAAGGCCGG + Intergenic
948857958 2:240739161-240739183 CAAGGTCACTTCCCTGAGGCTGG - Intronic
1172794252 20:37526292-37526314 CACGTTTAAATCTCTGAGGGGGG - Intronic
1172995363 20:39066396-39066418 AAAGTTAAAATTTCTGAGGCTGG - Intergenic
1173547634 20:43911099-43911121 CAAGGAAAAATCTGTGAGAGAGG - Intergenic
1174090666 20:48044481-48044503 CAAGGTAAAATTTCCCAGGAGGG + Intergenic
1177385770 21:20407715-20407737 CATGGTAAAATATTTGAGTCGGG - Intergenic
1179108184 21:38422247-38422269 CAAATTCAAATCCCTGAGGCAGG + Intronic
1179177126 21:39016365-39016387 CCAGGTAAAATTACTGAGGGGGG + Intergenic
1183101478 22:35586798-35586820 CAAAGTGAGACCTCTGAGGCTGG + Intergenic
949271336 3:2221025-2221047 CAAGGTAGAATCACTCAAGCAGG - Intronic
949921010 3:9000448-9000470 CATGGGAAAATCTCTGAGCCAGG - Intronic
950321447 3:12058610-12058632 CAAGATAAAATCACTGGGGAAGG + Intronic
950634803 3:14307329-14307351 CAGGGTGAAATCGGTGAGGCCGG + Intergenic
952424437 3:33160310-33160332 ACAAGTAAAATATCTGAGGCAGG + Intronic
952624253 3:35384486-35384508 CAAGCTAAACTCTGTGAGGTCGG - Intergenic
953170276 3:40500862-40500884 CAGGGTAAATTCTCTGATGTTGG - Intergenic
956439710 3:69268134-69268156 CAAGGTCAAATATCAGAGACTGG + Intronic
958053853 3:88384444-88384466 CAAGTAAAAGGCTCTGAGGCTGG + Intergenic
959342907 3:105153613-105153635 GAAGGTAACACCTCAGAGGCAGG - Intergenic
959962746 3:112318275-112318297 CAATGAACAATGTCTGAGGCTGG + Intergenic
962557055 3:136564237-136564259 CAAGGTAAAATCCCAGAAGTAGG + Intronic
962959825 3:140300466-140300488 CAATGCCAACTCTCTGAGGCAGG - Intronic
966970203 3:185038683-185038705 CAAGGAAAAATCTCTGAGCTGGG + Intronic
967760996 3:193226266-193226288 CCAGGCAAAACCTCTGAGCCAGG + Intergenic
967934200 3:194713629-194713651 CAGGGTAAAACCTCTGAAGTGGG + Intergenic
968799793 4:2734425-2734447 CCAGGCAAAATCTCTGAGCAGGG - Intergenic
969176053 4:5399877-5399899 CAAGGTCAAATCACAGAAGCAGG + Intronic
971595858 4:28527444-28527466 CAAGGTCAAATCCCTGAGGTTGG - Intergenic
974836643 4:67259381-67259403 CAAAATAAAATCTTTAAGGCTGG - Intergenic
974926524 4:68305517-68305539 CAAGGTAAAATAGCTGAGGTAGG + Intergenic
975270677 4:72428990-72429012 CATGGAAAAGTCTCTGAGGTTGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976840749 4:89430022-89430044 CAAGGAAACAGCTCCGAGGCAGG - Intergenic
979773185 4:124555388-124555410 CAAAGAAAAATCTTTGAGGGAGG + Intergenic
980442873 4:132870659-132870681 CAAGTTCAGATCTCTGAGTCTGG - Intergenic
981854236 4:149268279-149268301 CAAGTTAAAATGTCTGTGTCTGG + Intergenic
985067207 4:186134260-186134282 TCAGGTTTAATCTCTGAGGCTGG - Intronic
986089605 5:4491201-4491223 AAAGATAAAATCTTTGATGCAGG - Intergenic
989024939 5:37056519-37056541 CACTGTAAAAACTGTGAGGCAGG - Intronic
989232585 5:39102938-39102960 CAAGGCAAAATCACAAAGGCTGG + Intergenic
989621062 5:43384707-43384729 AAAGGTATAATCTCTATGGCAGG - Intronic
990005264 5:50938223-50938245 CAAGGCAAACTCTGTGAGACAGG + Intergenic
990209726 5:53469588-53469610 AAATGTAAAGTTTCTGAGGCAGG + Intergenic
992940947 5:81760725-81760747 CAAGGCAAAGGCCCTGAGGCTGG - Intergenic
993658316 5:90599662-90599684 TAAGGAAAAATCTCTGAGATTGG - Intronic
994278691 5:97871873-97871895 CATGGGAAAGGCTCTGAGGCAGG + Intergenic
995190096 5:109310597-109310619 CAAGTGAAACTCTCAGAGGCAGG + Intergenic
996628066 5:125594295-125594317 CAAGGCAAAGGCCCTGAGGCAGG + Intergenic
996903123 5:128566748-128566770 CAAGGTAAAATCCCTGGAGATGG - Intronic
997662001 5:135596398-135596420 CAAGGAAAAATCTCTGGGGAAGG + Intergenic
998411268 5:141913394-141913416 CAAGATAACTTCTCTGAGCCTGG - Intergenic
1003408404 6:5841600-5841622 CATGGAAAAAGCTCTGAGGCAGG - Intergenic
1004411046 6:15381940-15381962 CAACTTAAAATCTGTGAAGCAGG + Intronic
1004471097 6:15929764-15929786 CAGGTTGGAATCTCTGAGGCAGG + Intergenic
1006061233 6:31421422-31421444 CAAGCTAAAATCATTGAAGCTGG - Intergenic
1008082265 6:47206939-47206961 CAAGGAAAAATCTCTGGGAGAGG - Intergenic
1008504115 6:52212400-52212422 GAAAGTAAAATGCCTGAGGCTGG - Intergenic
1010615920 6:78012219-78012241 CAAGGACAAATCTTTGAAGCTGG + Intergenic
1010622259 6:78090803-78090825 CAATGCAAAATATCTGAGACAGG - Intergenic
1012433730 6:99192904-99192926 CAATGTTAAAGCTCTGAGGGAGG - Intergenic
1013661830 6:112305853-112305875 CCAAGAAAAATCTCTGAGACAGG - Intergenic
1015621691 6:135138758-135138780 TAAGGTAAAATCTCTGAGAGGGG - Intergenic
1017728552 6:157294015-157294037 CATGTTAAGATCTCTTAGGCTGG - Intronic
1019006025 6:168796796-168796818 CATGGTAATAACTTTGAGGCAGG + Intergenic
1019682108 7:2356078-2356100 CAGGAAAAAATCTCTGAGACAGG - Intronic
1021033222 7:15764364-15764386 CAAGGCAAGCTCTCTGAAGCTGG + Intergenic
1021145862 7:17088143-17088165 TGAGTTTAAATCTCTGAGGCTGG + Intergenic
1023608380 7:41950203-41950225 CACAGTATATTCTCTGAGGCTGG - Intergenic
1024035650 7:45505760-45505782 CCAGGTAAAATCCCAGAGTCTGG + Intergenic
1025062370 7:55821399-55821421 CAAGGTAAAATCTCTGAGGCAGG - Intronic
1025618001 7:63140853-63140875 CAAGCCAAAATCTCTGAGACAGG - Intergenic
1025810855 7:64874681-64874703 CTAGGTAAAATGCCTGAGGGGGG - Intronic
1028331208 7:89594347-89594369 CAAGGTACCATCTCTGAAACTGG + Intergenic
1028349056 7:89821024-89821046 CAAGGTATAATCTCAAAGGGAGG - Intergenic
1028721049 7:94032097-94032119 CAAGGAAGAATCTCAGAGCCTGG + Intergenic
1030241765 7:107334244-107334266 CAAGGTAACATGAATGAGGCTGG + Intronic
1030268346 7:107643933-107643955 TATAGTAAAATCTCTGAGGAAGG + Intergenic
1030761325 7:113356084-113356106 CAAGGGAGATTCTCTGTGGCTGG + Intergenic
1032527799 7:132593136-132593158 CAAGATAAAATCGCTGGGCCTGG + Intronic
1033074329 7:138234469-138234491 CAAGCTAAAAAATCTGGGGCCGG + Intergenic
1034639420 7:152590843-152590865 CAAGGTAAAATCCCTGGAGAAGG - Intergenic
1035958177 8:4106076-4106098 CTATGTAGAGTCTCTGAGGCAGG + Intronic
1037131906 8:15416779-15416801 CAAGGCAAAATGTTTGGGGCTGG + Intergenic
1039614696 8:38946134-38946156 GAAGGAAATATCTCTGAGACAGG - Exonic
1041856946 8:62468017-62468039 AAAAATAAAAACTCTGAGGCGGG - Intronic
1043453151 8:80388583-80388605 CAAGGTAAAATCTTTGAAATTGG + Intergenic
1043642016 8:82465726-82465748 TAAGCTAAATTCTCTGAGGCTGG - Intergenic
1046259515 8:111748323-111748345 TAAGGTAAAATTTCTGTGGATGG + Intergenic
1048488764 8:134872239-134872261 GAATGTAGAATCTCTGAGGAGGG - Intergenic
1050781110 9:9337292-9337314 AAAGGGAAAATCTGAGAGGCAGG + Intronic
1052034030 9:23659943-23659965 CAAGGTCAAGGCTCTAAGGCTGG + Intergenic
1052248475 9:26368176-26368198 AAAAGAAAAATCTCTGAGACAGG - Intergenic
1052456829 9:28710238-28710260 GAAGGTAACATCTGTGAGTCAGG + Intergenic
1052514902 9:29467717-29467739 CTGGGTAAAATCTCTGAGGAAGG + Intergenic
1052564446 9:30129554-30129576 CAAGGTAAAAGGTCTGAGGTAGG + Intergenic
1054858245 9:69924070-69924092 CCAGGCAAAATCTCTAAGCCAGG - Intergenic
1057435985 9:95040921-95040943 CCAGGTACAATCTTTGAGGAAGG - Intronic
1058042863 9:100323411-100323433 TTAGGTAAAATCTCTGAGGAAGG - Intronic
1059180566 9:112208843-112208865 GCAGGTACAATCTCTGAGCCAGG + Intergenic
1060389454 9:123267046-123267068 GAAGGAAAGATTTCTGAGGCGGG - Intronic
1061433314 9:130544851-130544873 AAAGGTAGAATAGCTGAGGCTGG - Intergenic
1186257071 X:7733371-7733393 CAAAGGAAAATCTCTGAACCAGG - Intergenic
1186434008 X:9528079-9528101 TAATGAAAAATTTCTGAGGCTGG - Intronic
1189207873 X:39257307-39257329 AAAAGCAAAATCTCTTAGGCTGG + Intergenic
1189943132 X:46148219-46148241 CATGATAAAATCTCTCAGCCAGG - Intergenic
1190093922 X:47463709-47463731 CAAGGAACAGTCACTGAGGCTGG - Intronic
1190556675 X:51642520-51642542 AGAGGTGAAAGCTCTGAGGCAGG + Intergenic
1191644055 X:63459913-63459935 CAAGGTCAAATCTGTGAGCTGGG - Intergenic
1192223543 X:69213400-69213422 CAATGCAAAGGCTCTGAGGCAGG + Intergenic
1193987110 X:88256879-88256901 CCAAGCAAAATCTCTGAGCCAGG + Intergenic
1195024802 X:100865922-100865944 CATGGAAAGATATCTGAGGCTGG + Intronic
1195030822 X:100926267-100926289 CTTGGTAAAATCTCTGAAGATGG - Intronic
1195595094 X:106679857-106679879 AAAAGTAAAATGTTTGAGGCTGG + Intergenic
1196344645 X:114639427-114639449 CAATCTAAAATCTAGGAGGCAGG + Intronic
1196779946 X:119374892-119374914 CAATGCCAAATCTCTGAGTCAGG - Intergenic
1198953321 X:142098076-142098098 AATGGTAAAAGCTCTGAGGCAGG + Intergenic
1199070075 X:143465841-143465863 CAATGGAACTTCTCTGAGGCTGG + Intergenic
1199321963 X:146450426-146450448 GAAGTTAAAATCTCTGAAGCAGG + Intergenic
1199937559 X:152590456-152590478 CAATGTCAAAGCTCTGAGACGGG + Intergenic
1200757620 Y:7005131-7005153 CAAGAACAAATCTGTGAGGCTGG + Intronic