ID: 1025067694

View in Genome Browser
Species Human (GRCh38)
Location 7:55872048-55872070
Sequence CTTTCTCTCCAGGAGGTATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025067694_1025067699 20 Left 1025067694 7:55872048-55872070 CCGCATACCTCCTGGAGAGAAAG No data
Right 1025067699 7:55872091-55872113 AAGCCACTGTTGTACCATCCCGG No data
1025067694_1025067701 24 Left 1025067694 7:55872048-55872070 CCGCATACCTCCTGGAGAGAAAG No data
Right 1025067701 7:55872095-55872117 CACTGTTGTACCATCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025067694 Original CRISPR CTTTCTCTCCAGGAGGTATG CGG (reversed) Intergenic
No off target data available for this crispr