ID: 1025067963

View in Genome Browser
Species Human (GRCh38)
Location 7:55874170-55874192
Sequence CATTGTTACCAGAGCGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025067962_1025067963 17 Left 1025067962 7:55874130-55874152 CCTTACAATTATTTGCATAGGTT No data
Right 1025067963 7:55874170-55874192 CATTGTTACCAGAGCGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025067963 Original CRISPR CATTGTTACCAGAGCGTAAT TGG Intergenic
No off target data available for this crispr