ID: 1025069456

View in Genome Browser
Species Human (GRCh38)
Location 7:55886386-55886408
Sequence CATTTTGCTTAATTGGAGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025069456_1025069460 10 Left 1025069456 7:55886386-55886408 CCGAACTCCAATTAAGCAAAATG No data
Right 1025069460 7:55886419-55886441 AAAAATTCCATTCTTTGGCCAGG No data
1025069456_1025069459 5 Left 1025069456 7:55886386-55886408 CCGAACTCCAATTAAGCAAAATG No data
Right 1025069459 7:55886414-55886436 CCTAAAAAAATTCCATTCTTTGG No data
1025069456_1025069462 18 Left 1025069456 7:55886386-55886408 CCGAACTCCAATTAAGCAAAATG No data
Right 1025069462 7:55886427-55886449 CATTCTTTGGCCAGGCGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025069456 Original CRISPR CATTTTGCTTAATTGGAGTT CGG (reversed) Intergenic
No off target data available for this crispr