ID: 1025069676

View in Genome Browser
Species Human (GRCh38)
Location 7:55887590-55887612
Sequence CGCCGCCGCCGCGGTGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 274}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025069676_1025069687 2 Left 1025069676 7:55887590-55887612 CCGGGTCCACCGCGGCGGCGGCG 0: 1
1: 0
2: 2
3: 43
4: 274
Right 1025069687 7:55887615-55887637 GGCGGCGGCGGCGGCGGCGGCGG 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
1025069676_1025069684 -7 Left 1025069676 7:55887590-55887612 CCGGGTCCACCGCGGCGGCGGCG 0: 1
1: 0
2: 2
3: 43
4: 274
Right 1025069684 7:55887606-55887628 GGCGGCGGCGGCGGCGGCGGCGG 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
1025069676_1025069685 -4 Left 1025069676 7:55887590-55887612 CCGGGTCCACCGCGGCGGCGGCG 0: 1
1: 0
2: 2
3: 43
4: 274
Right 1025069685 7:55887609-55887631 GGCGGCGGCGGCGGCGGCGGCGG 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
1025069676_1025069683 -10 Left 1025069676 7:55887590-55887612 CCGGGTCCACCGCGGCGGCGGCG 0: 1
1: 0
2: 2
3: 43
4: 274
Right 1025069683 7:55887603-55887625 GGCGGCGGCGGCGGCGGCGGCGG 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
1025069676_1025069690 11 Left 1025069676 7:55887590-55887612 CCGGGTCCACCGCGGCGGCGGCG 0: 1
1: 0
2: 2
3: 43
4: 274
Right 1025069690 7:55887624-55887646 GGCGGCGGCGGCGGCGTCAGGGG 0: 2
1: 111
2: 1270
3: 1914
4: 3402
1025069676_1025069691 12 Left 1025069676 7:55887590-55887612 CCGGGTCCACCGCGGCGGCGGCG 0: 1
1: 0
2: 2
3: 43
4: 274
Right 1025069691 7:55887625-55887647 GCGGCGGCGGCGGCGTCAGGGGG 0: 1
1: 7
2: 137
3: 539
4: 1146
1025069676_1025069689 10 Left 1025069676 7:55887590-55887612 CCGGGTCCACCGCGGCGGCGGCG 0: 1
1: 0
2: 2
3: 43
4: 274
Right 1025069689 7:55887623-55887645 CGGCGGCGGCGGCGGCGTCAGGG 0: 1
1: 20
2: 204
3: 475
4: 1124
1025069676_1025069688 9 Left 1025069676 7:55887590-55887612 CCGGGTCCACCGCGGCGGCGGCG 0: 1
1: 0
2: 2
3: 43
4: 274
Right 1025069688 7:55887622-55887644 GCGGCGGCGGCGGCGGCGTCAGG 0: 2
1: 213
2: 412
3: 818
4: 1974
1025069676_1025069692 15 Left 1025069676 7:55887590-55887612 CCGGGTCCACCGCGGCGGCGGCG 0: 1
1: 0
2: 2
3: 43
4: 274
Right 1025069692 7:55887628-55887650 GCGGCGGCGGCGTCAGGGGGCGG 0: 1
1: 0
2: 30
3: 254
4: 1158
1025069676_1025069686 -1 Left 1025069676 7:55887590-55887612 CCGGGTCCACCGCGGCGGCGGCG 0: 1
1: 0
2: 2
3: 43
4: 274
Right 1025069686 7:55887612-55887634 GGCGGCGGCGGCGGCGGCGGCGG 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025069676 Original CRISPR CGCCGCCGCCGCGGTGGACC CGG (reversed) Intronic
901526016 1:9823868-9823890 CGCCGCCGCCGCCGTGACGCTGG + Exonic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903750175 1:25616684-25616706 CGCCGCCGCCGCGCCGCAGCCGG - Intergenic
904063156 1:27726479-27726501 CCCCGCCGCCGCGGTCTCCCTGG + Intronic
904642008 1:31938133-31938155 CGCCGCCGCCGGGCCGGGCCGGG - Exonic
904822946 1:33256816-33256838 CGCCGCCGCCGCTCTGGGCCGGG - Intronic
906615821 1:47232207-47232229 GGCCGCCGCCGCTCAGGACCGGG - Intronic
906637010 1:47416484-47416506 CGCCGCCGCCGCCCCGGGCCGGG - Exonic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
912381453 1:109250034-109250056 AGCCGCCGCCGCCGTTGACCCGG + Exonic
913205526 1:116534637-116534659 CAGCGCCGCCGCGGCGGGCCTGG - Intronic
914286160 1:146228803-146228825 CGCCGCCGCCGCGGCCGCCTGGG + Exonic
916065508 1:161132647-161132669 CGCCGCCGCCGCCGCGGCCGTGG + Exonic
916390051 1:164321454-164321476 CGCCGCCGCCGCCCTGCTCCTGG + Intergenic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
917904476 1:179575663-179575685 CGCCGCCACGGTGGTGGACGTGG - Exonic
919486996 1:198157558-198157580 TGCCGCCGCCGCCGTGGCCACGG - Intronic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922119093 1:222644508-222644530 CGCCGCTACCCCGGGGGACCCGG + Intronic
922240845 1:223754799-223754821 CGCCGCCCCCTCGGTGAGCCCGG - Intronic
922705636 1:227788717-227788739 CGCCCCCGCCGCGGAGTCCCGGG + Intergenic
923318513 1:232805533-232805555 CCCCGCTGCCGCAGTGGAGCAGG + Exonic
1062898100 10:1120364-1120386 CGCCGCCTCCGAGGGGCACCCGG + Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1064086506 10:12349650-12349672 CGCCGCCGCCGCCGCGGCCGCGG - Exonic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1065025090 10:21534085-21534107 CGCCGCCGCCGAGGTGTGCTGGG - Intergenic
1065214915 10:23439622-23439644 CGCCGCGGCCGCCGAGCACCGGG + Exonic
1066429342 10:35336883-35336905 CGCCGCCGCCGCTGCTGACCCGG + Exonic
1067484540 10:46635495-46635517 CGCCGCCGCCGCGGTTGATGTGG - Intergenic
1067610219 10:47706152-47706174 CGCCGCCGCCGCGGTTGATGTGG + Intergenic
1071526759 10:86363770-86363792 CGCCGCTGCCTAGGTGGGCCGGG + Intronic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1072719507 10:97771944-97771966 CGCCGCCGCGGAGGTCGCCCAGG + Exonic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074182926 10:111078899-111078921 CGACACCGACGCGCTGGACCTGG + Exonic
1074995493 10:118754456-118754478 CGCGGCCGCCGCCGTGGCCAAGG - Exonic
1076554205 10:131311513-131311535 CGCCGCCGCCGCCCTGGGTCTGG - Exonic
1076566139 10:131400735-131400757 AGCCGCCTCCGCGGTGGCCCAGG - Intergenic
1077023389 11:429638-429660 CGCCGCAGCCACGGTGTTCCTGG - Exonic
1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG + Intergenic
1079237108 11:18698877-18698899 CGCCGCCGCCATGGTGTCCCCGG + Exonic
1079459758 11:20669465-20669487 CGCAGCCGCAGCGGGGGGCCGGG + Intergenic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1080503833 11:32893349-32893371 CGGCGGGGTCGCGGTGGACCAGG + Intronic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083887514 11:65580107-65580129 GGCCACGGCCGAGGTGGACCTGG + Exonic
1083904827 11:65662768-65662790 CGCCACAGCCGCGGCGGCCCCGG + Intronic
1083936640 11:65872938-65872960 TGGCGGCGCCGCGGGGGACCGGG - Intronic
1083970386 11:66070656-66070678 AGCCGCCGCCGAGGTGGACGAGG - Exonic
1084973034 11:72781709-72781731 CGCCGCCGCCGCAGCTGCCCGGG + Intronic
1085208099 11:74749162-74749184 CGCCGCCGACGCGGCGGGCCCGG + Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1085503125 11:77040379-77040401 CGCCGCCGCTGCAGTACACCGGG - Exonic
1085561098 11:77473670-77473692 CGCCGCCGCCGCGCTGCCCGTGG + Exonic
1089563220 11:119356415-119356437 CGCCCGCGCCGCGGAGGAGCCGG - Exonic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1091206571 11:133825331-133825353 CACCCCCACCGCGGTGGACCTGG + Intergenic
1091493190 12:950135-950157 GGCCGAGGCAGCGGTGGACCTGG + Intronic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091823169 12:3491301-3491323 CGCCGCCGCCGCGGAGGCTTCGG + Exonic
1091823256 12:3491746-3491768 CGGCGGCGGCGCGGTGGTCCGGG - Intronic
1092727682 12:11500720-11500742 CGCCGCCACCGCCGGGGCCCAGG + Intronic
1094375404 12:29783757-29783779 CGCCGCCGCCGCTGCTGCCCTGG + Exonic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096284142 12:50283543-50283565 CGCCCCCGCGGCGGTGGGCGGGG - Intronic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097929694 12:65170046-65170068 CGCCGCCGCCGGCCTGGTCCCGG - Exonic
1101466926 12:104958370-104958392 CGCCGCCGCCGGGGAAGCCCGGG + Intronic
1101970639 12:109309808-109309830 CCTCGCCGCCGCGCTGGGCCCGG - Intergenic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1104948195 12:132426789-132426811 GGCCTCTGCCGGGGTGGACCGGG + Intergenic
1106208409 13:27620509-27620531 CGCCGCCGCCGCGGATTTCCTGG + Intergenic
1106340218 13:28820172-28820194 AGCCGCGGCCGCGGCGGAGCCGG + Intergenic
1111672458 13:91348052-91348074 CGCCGCCGCCACGCTGCCCCGGG - Intergenic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1113200740 13:107866173-107866195 CGCCGCCGCCGCCGTCTCCCGGG + Exonic
1114483205 14:23047944-23047966 CCCCCCCCCCGCGGTGGGCCGGG + Exonic
1116186608 14:41606973-41606995 GGCCGCGGCCGGGGCGGACCCGG - Intergenic
1116617171 14:47154462-47154484 CCCAGCCGCAGCAGTGGACCCGG + Intronic
1116905087 14:50396634-50396656 CGCCGCCTCCGCGGGGAGCCGGG - Intronic
1117424418 14:55580243-55580265 CGCCGCCGCCGCAGTCGCTCAGG - Intronic
1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG + Intronic
1118849476 14:69573079-69573101 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1119286385 14:73458345-73458367 CGCCGCCTCCGCCCTGGCCCCGG + Intronic
1121616953 14:95319811-95319833 CGCCCGCGCCGCGCTGGCCCGGG - Exonic
1122130812 14:99603927-99603949 CGCCGCCGCCGCCGTCGCCGCGG + Exonic
1122418367 14:101560953-101560975 GGCCGCCGCTTCGGTGGCCCCGG - Intergenic
1122418449 14:101561226-101561248 AGCCGCTGCCGCTGGGGACCGGG - Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122620966 14:103057479-103057501 CGCCGCCGCCGCCGCAGACTAGG + Intergenic
1122885891 14:104710127-104710149 CGCGGCCGCCGTGCTGGACATGG + Exonic
1122917487 14:104865669-104865691 CGCCGCCGCGGAGGCGGCCCTGG + Intronic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1127763628 15:62164588-62164610 CGCCGCCGCAGCTGTGGGCCCGG + Exonic
1128028573 15:64460584-64460606 CGCCGCCGCCGCCGCGATCCGGG - Intergenic
1130076692 15:80695621-80695643 CGCCGCCGCCGCGGCCCAGCCGG + Exonic
1132255571 15:100373478-100373500 CGCCGCCGCCGCGCCTGGCCGGG - Intergenic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1135437208 16:22437102-22437124 CGCCGGGGCCGCGGAGGACGAGG - Intronic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1139761414 16:69187322-69187344 CGACGCCGCCGCGGCCGAGCTGG + Exonic
1139890626 16:70251393-70251415 CACCGCCGCCGCGCTCGCCCTGG - Exonic
1141054616 16:80804017-80804039 CGCCGCCGCCGCCGCGGGCTCGG + Intronic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141608590 16:85169273-85169295 CGCCGCCGCCGCCGCGTTCCGGG + Intergenic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1141719770 16:85749930-85749952 CGCCCCCACCGCTGGGGACCCGG - Intronic
1141840129 16:86568576-86568598 CGCCTGCGCCGCGGCGGCCCCGG - Exonic
1142811796 17:2399017-2399039 TGCCGCCGCCGCGGCGGGCGGGG - Intronic
1143148262 17:4790178-4790200 CGCCTCCGCCTCGGTGGCTCCGG - Exonic
1143590666 17:7884686-7884708 CGCCGCCGCCGAGGAGGAGGAGG + Intronic
1143633397 17:8151295-8151317 CGCCGCCGCCACGGTCGCCAGGG + Intronic
1143742582 17:8965417-8965439 CGCTGCCCCCGCGGTGGGCCAGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1148084833 17:44987829-44987851 CGCCGCCGCCGCCGTAGATGGGG + Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149421057 17:56511113-56511135 CGCAGCGGCCGTGGTGGCCCAGG + Intronic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1152049144 17:77958956-77958978 CGCCGCCGCCGCCTAGGACCCGG + Intergenic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1156275933 18:35582279-35582301 CGCTGCCCCCGAGGAGGACCCGG + Intronic
1157260971 18:46174854-46174876 CGCCGCGGCCGCAGTGGCCTTGG + Intronic
1158954699 18:62526615-62526637 CGCCGCCGCCGCCGCGCACCCGG + Intronic
1159040540 18:63319919-63319941 CAGCGCCGCCGCGCAGGACCAGG - Exonic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160967693 19:1753818-1753840 CGCCGCCGCCGCCGTCCAGCAGG - Exonic
1161224435 19:3136507-3136529 GGCCGCCGCCCGGGTGGACCAGG + Exonic
1161513201 19:4683061-4683083 CCCCGCCGCCGCAGAGGGCCGGG + Intronic
1161703248 19:5805944-5805966 CGCCGCCGCCGCCGGGGACACGG + Intergenic
1162412487 19:10514879-10514901 CGCCGACGCCGTGGTGTGCCTGG - Exonic
1162421585 19:10568750-10568772 GGGCGCGGCCGCGGTGCACCCGG + Exonic
1162751763 19:12833861-12833883 CGCCGCCGCCGCGGTCCCCGCGG + Intronic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1163708707 19:18832650-18832672 CGCGGCCGGAGCGGGGGACCCGG - Intronic
1163715628 19:18870548-18870570 CGGCCCCGCCCCCGTGGACCCGG - Exonic
1164834726 19:31349766-31349788 CGCAGCCGCCGCCGCGGCCCGGG + Intergenic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1166100359 19:40567979-40568001 CTCCGCCGCCGCGGGGGTCGCGG - Exonic
1166245420 19:41522215-41522237 CGCCGCCGCCGAGGCTTACCCGG - Intergenic
1166688354 19:44809106-44809128 CTCCGCCGCCGCCGTGAACATGG + Exonic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167139163 19:47637841-47637863 CGCCGCAGCAGCGGTGGACCTGG - Intronic
1167557473 19:50205306-50205328 CGCCGCCGCCGCCGCCCACCTGG + Intronic
1168100244 19:54137752-54137774 CGCCGCCGCCATCTTGGACCGGG + Intronic
925022645 2:583869-583891 CGGCGCCTCCTCGGTGGTCCTGG + Intergenic
927156549 2:20224456-20224478 CCCGGCCGCCGCGGTGGCCGGGG + Intronic
927713819 2:25340915-25340937 CGCCGCCACCGCGGCCGCCCGGG + Intronic
927714046 2:25341433-25341455 CGCCGCTGCCGCAGGGGCCCCGG - Intronic
927714283 2:25342106-25342128 CCCCGCGGCCGCGCTGGCCCCGG + Intronic
927938127 2:27086679-27086701 CGCCTCCGCCGCGGAGGAGCAGG - Intergenic
933750438 2:85599582-85599604 GGCCACCGCCCCGCTGGACCTGG - Exonic
934079060 2:88452307-88452329 CGCAGCCGCCGCCGCGTACCTGG - Exonic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
935746510 2:106194084-106194106 CCCCGGCGCCGCGGTGGGCCGGG - Intronic
937907028 2:127057454-127057476 CGCGGCGGCCGCGGCTGACCTGG + Exonic
940638864 2:156328091-156328113 GGCCGCAGCCGCGGGGCACCAGG + Intronic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942178396 2:173355894-173355916 AGTCGCCGCCCCGGTGGAGCTGG + Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942681348 2:178480624-178480646 CGCCGCCGCCGAGGCTTACCCGG + Exonic
943060675 2:183038571-183038593 CGCCGCCGCCGCTCTGGCCCTGG + Exonic
943185162 2:184598306-184598328 CGCCGCTGCCGCAGAGGGCCGGG - Intergenic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
946325333 2:218981915-218981937 TGCCGCCGCCGCGGCCGCCCAGG - Exonic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
1169171827 20:3471349-3471371 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1173672872 20:44810292-44810314 CGCCGCCGCCGCCGCGGCCGAGG - Intronic
1175847007 20:62064803-62064825 CGCAGCCGCCGCGCCGGGCCCGG + Exonic
1175847236 20:62065366-62065388 CGCCGCCGCCGCCGTCGCCGCGG - Exonic
1175887917 20:62302828-62302850 CGCCGGCGCGGGGGCGGACCGGG + Intronic
1176180420 20:63747142-63747164 CGCCTCCGCCGCCATGGTCCAGG + Exonic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1179882680 21:44300102-44300124 CGCCATGGCCGCGGTGGACCTGG + Exonic
1181478095 22:23180839-23180861 CGCCGCCGCCGCGCGGGCCATGG + Exonic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183702166 22:39457106-39457128 CTCCGCCGCCGCGCCGGGCCGGG - Intergenic
1184472258 22:44702543-44702565 GGCCGCCGCCGCGGACGAGCGGG + Exonic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185055261 22:48575859-48575881 CACCGCCGCCGCGGCGGGCCAGG - Intronic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185397662 22:50600979-50601001 CCCCGCCGCCGGCGCGGACCCGG + Intronic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
951613910 3:24521697-24521719 GGCCGCGACCACGGTGGACCCGG - Intergenic
951981870 3:28575564-28575586 CCCCGCCTCCGCGCTGGCCCTGG - Intergenic
954063583 3:48088774-48088796 CGCCGCCGCCGAGACGGAGCTGG + Exonic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961665773 3:128492546-128492568 CGCATCCGCCGCGGTGGCCTGGG + Intronic
961745674 3:129062204-129062226 CGCCGTGGCCGCGCTGGGCCTGG + Exonic
961827181 3:129605310-129605332 CGCCACCGCCCGGGTGTACCTGG + Exonic
961827257 3:129605652-129605674 CGCCGCCGGCGCCGTGGGGCAGG + Exonic
963939894 3:151087107-151087129 CGCCGGCGCTGCGGTGGAAGAGG + Intronic
968514415 4:1010271-1010293 CGCAGCCGCCGCTGTGCACCCGG - Intronic
968701131 4:2058849-2058871 AGCAGCGCCCGCGGTGGACCTGG - Intergenic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
975883607 4:78939397-78939419 CGCCAGCGCCGCGGCGGACCCGG + Exonic
976184110 4:82428981-82429003 CGCAGGCGCCGCGTGGGACCCGG - Intronic
980013601 4:127623292-127623314 TCCGGCCGCCGCGGTGAACCTGG - Intronic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
984765721 4:183398925-183398947 GCCCGCGGCCGCGGCGGACCCGG - Intergenic
988825327 5:34929742-34929764 CGCCGCCGCCGCTTCGGCCCGGG + Exonic
990557739 5:56952180-56952202 CGCCACCGCCGCGGTCCGCCCGG + Intronic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
995052738 5:107724771-107724793 GGCCGCCGCCGCCGGGGGCCGGG - Intergenic
995650112 5:114361180-114361202 CGCCCCCGCCAGGGGGGACCCGG + Intronic
997582887 5:135028349-135028371 CGTCCCCGCCGCGCTGGATCCGG - Exonic
999322650 5:150624850-150624872 CGCCGCCGCCTCGGCACACCTGG - Intronic
1000302890 5:159972052-159972074 CGCCGCCGCCGCCGTCGCCTGGG + Exonic
1001959564 5:175872020-175872042 CGCCGCAGCCGGGGCGGTCCTGG - Intronic
1002211125 5:177600065-177600087 CGCGGCCGGAGCGGCGGACCCGG + Intergenic
1002541229 5:179907713-179907735 CGCCGCCCCTGCCGTGGCCCCGG + Exonic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1002927302 6:1611774-1611796 CGCCGCCGCCGCCGTGACTCAGG - Exonic
1004492372 6:16129104-16129126 CGGCGCCACCGCGGAGGACAGGG + Exonic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1006304083 6:33208514-33208536 CACCGCCGCCGCCATGGCCCGGG - Exonic
1006337406 6:33427900-33427922 CGCCGCTGCCGCCGTTGCCCGGG - Intronic
1006617944 6:35342571-35342593 CGCTGCGGCCGCCGCGGACCTGG + Intronic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1007614332 6:43171514-43171536 CGCGGCCGCCGCTGCGAACCCGG - Exonic
1007689213 6:43687834-43687856 CGCCGCCGCAGTGGTGGGGCAGG + Intergenic
1008649065 6:53544942-53544964 CGCCGCCGCCGCATCGGAGCGGG - Exonic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1013507594 6:110815342-110815364 CGCCGCCGTCGCGGAGGAGGAGG - Intronic
1015625936 6:135181191-135181213 CGCCGCCTCCGCGGTCGCCCTGG - Intergenic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1017672410 6:156779287-156779309 CGCCGCCGCCGCCTGGGACTGGG - Exonic
1017719860 6:157236572-157236594 CTGCTCCGCCGAGGTGGACCCGG + Intergenic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1021600223 7:22356986-22357008 CACCGCCGCCGCGGCGGCCAGGG + Intronic
1022427954 7:30285552-30285574 CGCGGCGGCCGCGGCGGCCCCGG + Exonic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1024963799 7:55004595-55004617 CCCCGCGGCCGCGGCGAACCTGG - Intergenic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1026732753 7:72925568-72925590 CGCCGCCGCTCCGGAGGGCCAGG + Intronic
1029640255 7:101815897-101815919 CGCCGCCGCCACCGAGGACGCGG - Intronic
1029640513 7:101816683-101816705 TGCCGCCGGCGCGGCGGAGCTGG + Intronic
1029927012 7:104328809-104328831 CGCCGCCGCCGCGATGCTCCCGG + Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1032130756 7:129225361-129225383 CGCCGCCGTCGCGGTGCCGCTGG - Exonic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1033400152 7:141015122-141015144 CGCCGCCTGTGCGGAGGACCCGG + Intronic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034509023 7:151519540-151519562 CACCGCCGCCGCGGTTGATGTGG - Exonic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1036432327 8:8702376-8702398 CGCCGTCGGCGCGGCGGGCCGGG + Exonic
1036789502 8:11708672-11708694 CGCCGCCGCTGCCGCGGCCCGGG + Exonic
1038429857 8:27491324-27491346 CGCCGCCGCCGCAGTGGGTCGGG + Intronic
1038632941 8:29262941-29262963 CGCCTCCGCCCCGGCGGCCCAGG + Intronic
1041369435 8:57143370-57143392 CGCCGGGGCCGGGGTGGGCCGGG + Intergenic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1043502807 8:80873844-80873866 CGCCGCCGCCGCGCAGCGCCGGG - Intronic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049693753 8:143973739-143973761 CGCCGACACCGCGGTCGCCCGGG + Intronic
1049788577 8:144462775-144462797 CGCCGCCGCCTCAGTGGGCCCGG + Intronic
1050437929 9:5629199-5629221 CGCCGCCGCCGCCGCCGACTCGG + Exonic
1051287300 9:15510463-15510485 CGCTGCCTCCGCGCTGGAGCAGG + Intronic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1054798642 9:69325428-69325450 CGCTGCGGCCGCGCTGGCCCCGG + Intronic
1054798675 9:69325549-69325571 CGCCGCTGCCGCCGCGGCCCCGG + Intronic
1057489129 9:95508310-95508332 TGCCGCCGCCGCCGCGGTCCTGG + Exonic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057623267 9:96655224-96655246 CGGCGCCGCCGCCCTGGTCCCGG - Exonic
1057752412 9:97803494-97803516 CCCCGCCCCCGCGCTGGGCCGGG - Intergenic
1059414796 9:114155976-114155998 CGCCGCCGCCGCTGTGCCTCGGG - Exonic
1059769782 9:117414623-117414645 CGCCGCCGCCGCCGCGTCCCCGG - Exonic
1060634561 9:125189734-125189756 CGCCGCCGCCGCTGTTGCCGCGG - Exonic
1060811769 9:126614359-126614381 CGCCGCCGCGGCCCTGGAACCGG - Intergenic
1060970569 9:127735180-127735202 CGCGGCCGCCGCCTGGGACCTGG - Exonic
1061208511 9:129177630-129177652 CGCCGCCGCCGCGCAGCCCCTGG + Exonic
1061208545 9:129177761-129177783 CGCCGCCGCCAAGTTGGAGCGGG + Exonic
1061540738 9:131276925-131276947 CGCCGCGGCCGCCGAGGACCTGG + Intergenic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061656978 9:132099796-132099818 CTCCGCCTCCGTGGGGGACCAGG + Intergenic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1062306022 9:135907484-135907506 CGCCGCCGCCGCCGCTCACCCGG - Intergenic
1062442741 9:136578459-136578481 CGCCCCCACCGCTGTGGCCCAGG + Intergenic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1187533525 X:20116861-20116883 CGCCGCCGCCGCGCTCCATCGGG + Exonic
1187826286 X:23335261-23335283 CGCCGCGGCCGCGGTCGGGCTGG + Intronic
1189324042 X:40102456-40102478 CGACGCCGCCGCGCTGGGCCGGG + Intronic
1189325561 X:40109015-40109037 CGCCGCCGCCGCCGCGTTCCCGG - Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196684026 X:118495708-118495730 CGCCGCCGACGCCGTGGGGCAGG + Intergenic
1198051629 X:132957445-132957467 CGCCGCCGCCGTGGAGTACTCGG - Intronic
1198276379 X:135098619-135098641 CGCCGACGCCGCCATGGGCCCGG + Intergenic
1198310131 X:135422124-135422146 CGCCGACGCCGCCATGGGCCCGG - Intergenic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic