ID: 1025071320

View in Genome Browser
Species Human (GRCh38)
Location 7:55901655-55901677
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025071314_1025071320 10 Left 1025071314 7:55901622-55901644 CCAGATTGGTGAACACATACAGG 0: 1
1: 0
2: 7
3: 60
4: 266
Right 1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type