ID: 1025072480

View in Genome Browser
Species Human (GRCh38)
Location 7:55912552-55912574
Sequence GATTCTGCTTTGTGTAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025072480 Original CRISPR GATTCTGCTTTGTGTAGGTA TGG (reversed) Intronic
905193309 1:36253429-36253451 GCTTCAGATTTGTGTGGGTATGG + Intronic
905371624 1:37485556-37485578 GCTTCTGCTGTGTGTGGGGAGGG + Intergenic
911402581 1:97394936-97394958 GAATCTGGTTTATGCAGGTAAGG + Intronic
911469440 1:98298937-98298959 GAAGCTGCATTGGGTAGGTAAGG + Intergenic
914434765 1:147650106-147650128 AACTCTGCTTTGTGCAGCTAAGG - Intronic
916207631 1:162330942-162330964 GTTTCTGGCTTGAGTAGGTATGG + Intronic
917055962 1:170981936-170981958 GATTCTGCTATGTGTTGTTAAGG + Intronic
917293724 1:173496788-173496810 TAATCTTCTTTGTATAGGTAGGG - Intergenic
918251774 1:182709389-182709411 TATTCTGGTTTGAGTGGGTATGG - Intergenic
918734857 1:188047840-188047862 GAGCCTGCTAAGTGTAGGTATGG - Intergenic
919152069 1:193713849-193713871 GATTATACTTTGCGTAGGAAGGG + Intergenic
920968196 1:210719313-210719335 GATTCTGCTATTTGTAGGCATGG + Intronic
1063284815 10:4674892-4674914 GATCCTGCCTTGTGTATGCATGG - Intergenic
1063566860 10:7178717-7178739 GAATCTGCTTTTTGTAGCTCTGG - Intronic
1063757078 10:9024272-9024294 GATTTTGCTTTGTGGAGTAATGG + Intergenic
1063903472 10:10759674-10759696 GATTCTCCTATGTGTTGTTAGGG - Intergenic
1065591692 10:27268934-27268956 GATTCTGCTGGGTGCAGATAGGG - Intergenic
1065653103 10:27915142-27915164 GATTATGATGTGTGTAGGTGTGG - Intronic
1065659314 10:27989262-27989284 GATTCTGCTGGGTGCAGATAGGG + Intronic
1069278586 10:66624937-66624959 GATTCTGCTTTTTGTAGACTTGG - Intronic
1070175300 10:73964859-73964881 TTTTCTGCTTTTTGTAGGGATGG + Intergenic
1070183210 10:74034488-74034510 GTTTCTGCTCTGCGTAGGTGAGG - Intronic
1072270408 10:93770679-93770701 GATTCTGCTGTCTGTAGGGACGG - Intronic
1077709567 11:4522660-4522682 GATTCTCCTCTGTCTAGGGATGG - Intergenic
1079645949 11:22864015-22864037 TATTCTACTTTGTGAAGGCAGGG - Intergenic
1080664491 11:34323840-34323862 TGTTTTGCTTTGTGTTGGTAAGG - Intronic
1083501914 11:63116553-63116575 GATTATACTGTGTCTAGGTATGG + Intronic
1083701355 11:64480269-64480291 GATTCTGGTTTGCATGGGTAAGG + Intergenic
1085566204 11:77516111-77516133 GATTATTCTTTGTGTAGTTGAGG - Intronic
1085735786 11:79037873-79037895 GATTCTGATTTGATTAGGGAAGG - Intronic
1088287700 11:108205040-108205062 GATTATGGTCTGTCTAGGTATGG - Intronic
1088395281 11:109361268-109361290 GATTGTGTTTTGTGGAGGTGTGG + Intergenic
1089360963 11:117886148-117886170 GATTTTGCTTGTTGTAGGAAGGG + Intergenic
1091056633 11:132425184-132425206 GTTTGTGCTTTTTGAAGGTATGG - Intronic
1091430696 12:431398-431420 TATTTTACTTTGTGTAGGAAGGG + Intronic
1094121555 12:26980024-26980046 GCTTCAGCTTTCTGTAGGTCAGG + Intronic
1097809598 12:64003889-64003911 TATTATGATGTGTGTAGGTATGG - Intronic
1100729253 12:97445911-97445933 TATTCTCCTTTGTCTTGGTATGG + Intergenic
1103538301 12:121648631-121648653 GATTCTGATTTAAGTAGGTCTGG + Intergenic
1106128498 13:26920673-26920695 GATTCTGCTTAGAGGAGGTAAGG + Intergenic
1109869909 13:68321195-68321217 GCTGCTGCTTTGTGTAGAGAAGG + Intergenic
1110046910 13:70842567-70842589 GCTGCTGCTTTGTGTAGGGAAGG - Intergenic
1110516030 13:76413293-76413315 AATTCTGCATTGGGTAGGAATGG - Intergenic
1110949502 13:81467057-81467079 CATTCTTCTTTTTGTAAGTAGGG - Intergenic
1112867924 13:103930093-103930115 TTTTCTGCTTTGTGTAAATATGG + Intergenic
1113658273 13:112084446-112084468 GAATCTGCTTTTTGTCAGTATGG + Intergenic
1114414916 14:22535915-22535937 GATTCTGCTTTGTATACCTTGGG - Intergenic
1115862769 14:37707609-37707631 GATTCTGCTTTGTGTTCTTGAGG - Intronic
1116295419 14:43100743-43100765 CCTTCTGCTCTGTGTAGGAAGGG - Intergenic
1116788167 14:49310633-49310655 GATTCTTTTAGGTGTAGGTAAGG - Intergenic
1119944942 14:78683518-78683540 TATTCTGCTTTGTGAAGCTGGGG - Intronic
1121474129 14:94179257-94179279 TATTCTGCTTTCTGTATCTATGG + Intronic
1122760315 14:104020094-104020116 GAGTCTGTTTTGTGGAGGTCAGG + Intronic
1202834574 14_GL000009v2_random:68371-68393 GATTCGGCTGTGTGTCGCTATGG + Intergenic
1124093538 15:26628563-26628585 GATTCAGCTATGTGAAGGGAAGG + Intronic
1127259046 15:57314552-57314574 GAATCTGCTTTTTGTTTGTATGG + Intergenic
1127617880 15:60705159-60705181 GGTTTTTCATTGTGTAGGTAGGG - Intronic
1128031122 15:64481002-64481024 GATTCAGGTTTCTGTAGGTCAGG + Intronic
1130190101 15:81726206-81726228 GTTTCTGCTTTGAGCACGTAAGG - Intergenic
1130584397 15:85169160-85169182 GATTGGGCTTTATGTAAGTATGG - Intergenic
1130621759 15:85470306-85470328 GATTCTGTTTTGTTTTGGTTTGG - Intronic
1132003408 15:98203084-98203106 GTATCTTCCTTGTGTAGGTACGG - Intergenic
1133701274 16:8311434-8311456 GCTTCTCCTTTCTATAGGTATGG + Intergenic
1135154129 16:20037748-20037770 GATTCTGCTTTGTTTATTTTCGG + Intronic
1135341523 16:21652526-21652548 CATTCTATTTTGTGTCGGTAAGG - Exonic
1136560568 16:31036833-31036855 GAGTGTGCTTTGTCTAGGGAGGG + Intronic
1140205027 16:72926761-72926783 GTCTCTGCTTTGTGTAGGAGAGG - Intronic
1141519511 16:84568601-84568623 GAGTCTGCTTTCTGTCTGTATGG - Intronic
1142770086 17:2090328-2090350 TATGCTGCTTTATGAAGGTAGGG + Intronic
1144666352 17:17104920-17104942 GATTCTTCTTGGTTTAGGGAGGG + Intronic
1144842956 17:18199738-18199760 CACTCTGCTTTGTGTTGGAATGG - Intronic
1146467404 17:33097037-33097059 GGATCTGCTTTGTGTGGCTAGGG - Intronic
1146634439 17:34493652-34493674 GATTCTGCCCTGGGCAGGTAAGG - Intergenic
1150767654 17:68014893-68014915 TAATGTGCTTTGTTTAGGTAGGG + Intergenic
1151237607 17:72732744-72732766 GTTAGGGCTTTGTGTAGGTAAGG + Intronic
1155360717 18:24998135-24998157 GATTCTTCTTTTTCTATGTAAGG - Intergenic
1160591057 18:79944936-79944958 GCTTCTGCTCTGTGTTGATAAGG - Intronic
1162686778 19:12393291-12393313 GAACCTGGATTGTGTAGGTAAGG - Exonic
1162691130 19:12433065-12433087 GAACCTGGATTGTGTAGGTAAGG - Exonic
1202638119 1_KI270706v1_random:59323-59345 GATTCGGCTGTGTGTCGCTATGG - Intergenic
924989856 2:304122-304144 GATACTGATTTCTTTAGGTAGGG + Intergenic
928280794 2:29944635-29944657 GATTCTGTTTTGTGTCAGCAGGG - Intergenic
932028123 2:68156306-68156328 GAATCTGCTTGGAGGAGGTAGGG - Intronic
932409494 2:71537005-71537027 GGTTCTGTTTTATGGAGGTAGGG - Intronic
933888853 2:86746367-86746389 GATTCAGCTTTGGTTAGGTTTGG + Intronic
935930698 2:108121447-108121469 GATTATGCTATGTCTAGGTATGG - Intergenic
936790317 2:116143446-116143468 GATTCTACTTGGTGTGGGCACGG + Intergenic
938449704 2:131406579-131406601 GAGTCTCCTTTGGGTAGTTATGG + Intergenic
938611272 2:132949671-132949693 GCTTTTACTTTATGTAGGTATGG - Intronic
938654894 2:133421263-133421285 GATGCTGCTTTATATAGGCAGGG - Intronic
939156764 2:138534794-138534816 TAATCTGCTTTTTGTATGTATGG + Intronic
939326519 2:140696999-140697021 GATTTTCCATTTTGTAGGTAAGG + Intronic
940554001 2:155199138-155199160 GATTCTGCTATGTCTAGTTGTGG - Intergenic
940634355 2:156279535-156279557 GATACAGCTTTGGGTAGCTAGGG + Intergenic
941461022 2:165772205-165772227 AATTCTGCTTCTTGAAGGTAAGG - Intronic
942251675 2:174052866-174052888 GTTTCTGCTGGGTGTAGGTGAGG - Intergenic
942976264 2:182021816-182021838 CTTTCTGTTTTGTGTAGGAAAGG - Intronic
943923208 2:193737793-193737815 GATTCTGCTCTGGCTAGGGAGGG - Intergenic
945296056 2:208172475-208172497 AATTCTGCATTGGGTAGGCAGGG - Intronic
948789644 2:240370605-240370627 GTCTCTGCCTTGTGTAGGTGGGG - Intergenic
1170297609 20:14845739-14845761 AATTCTGCTTGGGGAAGGTATGG - Intronic
1170917668 20:20643235-20643257 GATTCTGCTGGGTATGGGTAGGG - Intronic
1170958552 20:21003903-21003925 GAGTCTGCTTTGTGTTGGGTGGG - Intergenic
1171975877 20:31594355-31594377 GATTCTGAATTGTGTATGTGTGG + Intergenic
1174420672 20:50397144-50397166 TATTCCGCTTTGTGAAGTTAGGG - Intergenic
1180363848 22:11922557-11922579 GATTCGGCTGTGTGTCGCTATGG + Intergenic
1181961405 22:26624585-26624607 GCTTCTGATTTGTGCAGGTGGGG + Intronic
1184056730 22:42057006-42057028 GATTATGATATGTCTAGGTATGG + Intronic
1184687524 22:46103371-46103393 GCTTCTGCTCTGTGCAGGTCGGG + Intronic
949444771 3:4122351-4122373 CAATCTGCTTTGTGTTTGTATGG - Intronic
949825557 3:8161529-8161551 GATTTTCCTTTGTGGAGGTGAGG + Intergenic
950973484 3:17214714-17214736 GATTCTGGTTTCTGTAATTAAGG - Intronic
952944807 3:38472212-38472234 GATGCTGCTTTGTGGAGCTGGGG + Intronic
956500147 3:69873881-69873903 AATTCTGATTTGTTTAGGTAAGG - Intronic
956708633 3:72021116-72021138 GAGTCTGCATTTTGTATGTAAGG - Intergenic
959230576 3:103645899-103645921 GATTGTGCTATGTGGAGCTAAGG + Intergenic
960386842 3:117030677-117030699 TATTTTTCTTTGTATAGGTAGGG - Intronic
960388275 3:117047721-117047743 GCTTCCTCTTTGTGTTGGTATGG + Intronic
964155268 3:153577368-153577390 GATTCTGTTTTAGGTGGGTATGG - Intergenic
965386181 3:168049219-168049241 GCTTCTGCTTGCTGTAGGTGTGG - Intronic
965552758 3:169985794-169985816 GATTCTTCTAGGTGTATGTATGG + Exonic
966052951 3:175643805-175643827 GATTCTTGGTTGTGAAGGTAAGG - Intronic
966996703 3:185288796-185288818 GATTCTGTTTTGTGTTGTTTTGG + Intronic
967956473 3:194881217-194881239 GAGTCTGCTTTGTGCTTGTACGG - Intergenic
972912028 4:43829287-43829309 GTTTCTTCATTGTATAGGTAGGG + Intergenic
973107152 4:46354329-46354351 GTTTCTGTTGTGTGTAGGAAAGG + Intronic
973144405 4:46806424-46806446 GATTTTGCTTTGTATATTTAAGG + Intronic
975464667 4:74695806-74695828 TATTCTTCATTGTATAGGTAAGG + Intergenic
976230737 4:82840473-82840495 GAATCTTATTTGTGTAGTTAAGG + Intronic
979704548 4:123706689-123706711 GATTTTGCTTTTTGTAAGGAAGG + Intergenic
979939684 4:126744862-126744884 GATTGTGATGTGTCTAGGTATGG - Intergenic
980749447 4:137070202-137070224 GCTGCTGCTTTGTGTAGACAGGG + Intergenic
980985271 4:139689186-139689208 GATGCTGCTTGGTATTGGTAAGG - Intronic
981144595 4:141309778-141309800 TATTCTGCTTTGTGAAGGCTGGG - Intergenic
981317966 4:143359978-143360000 GATTCTCATTTCTGTAGGTTGGG + Intronic
982640044 4:157946894-157946916 GATCCTGCTTCATGTAGATATGG - Intergenic
982885464 4:160774726-160774748 GTTTTTCCTTTGTTTAGGTAGGG + Intergenic
985320392 4:188704080-188704102 GAATCTGCTTTGTGTCTCTATGG + Intergenic
1202765449 4_GL000008v2_random:145180-145202 GATTCGGCTGTGTGTCGCTATGG - Intergenic
986008417 5:3687702-3687724 GATTTTGTTTTGTTTTGGTATGG + Intergenic
987431120 5:17834551-17834573 GGTTTTGTTTTGTGTAGGGATGG - Intergenic
989084490 5:37661269-37661291 AATGCTGCTTTGTGTCTGTAGGG + Intronic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993707771 5:91190712-91190734 GATTCTTCTTTGTGGGGGAAAGG - Intergenic
994324089 5:98428360-98428382 GAATCTGCTATCTGTAGGTCTGG + Intergenic
1002072653 5:176689548-176689570 GATGCTACTTTGTGTGGGGAGGG - Intergenic
1003362185 6:5438279-5438301 GATTTTGATATGTCTAGGTATGG + Intronic
1003492547 6:6636209-6636231 GATTCAGCTCTATGTAGGTCTGG - Intronic
1004440140 6:15642127-15642149 GTTGCTGCTCTGTGTAGGGAAGG - Intronic
1005448422 6:25950083-25950105 GATTATGATGTGTCTAGGTATGG + Intergenic
1005590338 6:27318267-27318289 CATTCTGCTTTGTGAAGCTGGGG - Intergenic
1005874046 6:29997982-29998004 GATTCTGCTTCCTGTAGCTGAGG - Intergenic
1012176307 6:96089721-96089743 GTTACTTCTTTGTGTTGGTAGGG - Intronic
1015185968 6:130415777-130415799 TATTGTGCTATGTGTATGTAAGG + Intronic
1015270171 6:131329606-131329628 AATTCTGCTTTGTGTAAAGATGG + Intergenic
1015328685 6:131952172-131952194 GATTCTGTGTTGGGTAGGTAGGG + Intergenic
1015484968 6:133759104-133759126 GATTTTGCTTTGTCTGGGAAAGG - Intergenic
1018963179 6:168463240-168463262 GATTCTCCTTGGGGTAAGTACGG - Intronic
1019862948 7:3677173-3677195 GATTCTGCTCTGTGTGCGAAGGG + Intronic
1021762025 7:23911446-23911468 AATTCTGCTTTGTCTTTGTAAGG + Intergenic
1022378235 7:29835282-29835304 GATTCAGTCTTGTGTAGATAGGG - Intronic
1024942890 7:54780719-54780741 GGTGCTGCTGTGTCTAGGTAGGG - Intergenic
1025072480 7:55912552-55912574 GATTCTGCTTTGTGTAGGTATGG - Intronic
1032676389 7:134133689-134133711 GATTCTGATTTGTATATGGATGG + Intronic
1034692950 7:153028541-153028563 GATTCTGCTTTCTGTCTGTATGG + Intergenic
1034708551 7:153170539-153170561 GCTGCTGCTTTGTGTAGAGATGG + Intergenic
1035287877 7:157817627-157817649 GATGCTGCTTTGTGCAGGTCGGG - Intronic
1035905848 8:3509434-3509456 GATTCTGCCTTCTATAGGCAAGG + Intronic
1036582946 8:10092842-10092864 GATTTTGCTTTGTGTATTTTGGG + Intronic
1037508799 8:19560969-19560991 TATTCTGCTGTGTGTAGCTGTGG - Intronic
1038717613 8:30005927-30005949 GAATCTGATTTGTGTACTTAAGG + Intergenic
1038801509 8:30753702-30753724 CAATCTGCTTTCTGTTGGTATGG + Intronic
1041398089 8:57412528-57412550 GATTCTGCTCTGTGTTGGTGGGG + Intergenic
1043794423 8:84518318-84518340 AATTCTGCTTTCTATAGCTAAGG + Intronic
1043910877 8:85862519-85862541 GATTCTGATCTGGGTAGGTTTGG - Intergenic
1044030706 8:87232509-87232531 AATTCTGATTTGTATAAGTATGG + Intronic
1044730415 8:95224538-95224560 GGCTCTGCTTTGGGTAGGAATGG + Intergenic
1049948149 9:618086-618108 AATTCTGCTTCCTTTAGGTAAGG + Intronic
1050302386 9:4272935-4272957 GATTTTACTTTATTTAGGTAGGG - Intronic
1051143947 9:14007318-14007340 GATGCTGCAGTGGGTAGGTATGG + Intergenic
1203546194 Un_KI270743v1:130069-130091 GATTCGGCTGTGTGTCGCTATGG - Intergenic
1185756624 X:2658943-2658965 GATTCTGCATTGTGAATGTCAGG + Intergenic
1186924177 X:14313938-14313960 TATTCCGCTTTGTGAAGCTATGG - Intergenic
1188871701 X:35381529-35381551 GCTGCTGCTTTGTGTACGGATGG + Intergenic
1190025132 X:46915068-46915090 GATATGGCTTTGTGTAGGTTAGG - Intronic
1190333082 X:49247752-49247774 GCGTCAGCTTTGTGCAGGTAAGG + Exonic
1190699742 X:52978833-52978855 CTTTCTCCTTTGTGAAGGTATGG - Intronic
1191706169 X:64096626-64096648 GATTCTGCTTGTTGGACGTAAGG + Intergenic
1192899754 X:75483839-75483861 GATTCTGCTTTGTGTGTGTGTGG - Intronic
1195225146 X:102784919-102784941 AATTCTGCTTTGGCTAGGTCTGG + Intergenic
1196642985 X:118085335-118085357 GATTCTGCTTTCTGTTTCTATGG - Intronic
1197381371 X:125745984-125746006 AAATCTGCTTTGTGTTTGTATGG + Intergenic
1200941136 Y:8783254-8783276 GATGCAGCTTTTTGTAGATATGG + Intergenic