ID: 1025078075

View in Genome Browser
Species Human (GRCh38)
Location 7:55960467-55960489
Sequence CCGTCTCTAAAATATTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025078068_1025078075 26 Left 1025078068 7:55960418-55960440 CCTAGCATATGGTGACACATGTG 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1025078075 7:55960467-55960489 CCGTCTCTAAAATATTTTAAAGG 0: 1
1: 0
2: 1
3: 22
4: 265
1025078072_1025078075 0 Left 1025078072 7:55960444-55960466 CCAGCTCTGGGATGGAGTCCAAG 0: 1
1: 0
2: 1
3: 16
4: 197
Right 1025078075 7:55960467-55960489 CCGTCTCTAAAATATTTTAAAGG 0: 1
1: 0
2: 1
3: 22
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025078075 Original CRISPR CCGTCTCTAAAATATTTTAA AGG Intronic
900851702 1:5148493-5148515 CATTCTTTAAAATAATTTAAGGG + Intergenic
901987504 1:13087597-13087619 CTGTTTCTAAAATAATGTAAGGG - Intergenic
901994308 1:13139170-13139192 CTGTTTCTAAAATAATGTAAGGG + Intergenic
903840627 1:26236651-26236673 CAGACTCTGAAATATTTGAAGGG + Intronic
905219568 1:36435442-36435464 CAGTCTCTAAACTTTTTTAAAGG + Intronic
906029654 1:42708372-42708394 CCGTCTCTACAAAAATTAAAAGG - Intergenic
908514364 1:64876942-64876964 GCTTCTATAAAATGTTTTAATGG + Intronic
908698696 1:66874000-66874022 CCATCACTAAAATAATTTTAGGG - Intronic
909478427 1:76108683-76108705 GGGTCTCTAAACTATTTTATGGG + Intronic
909590545 1:77343730-77343752 CGGTGTCTAGAATATTGTAAGGG + Intronic
910021855 1:82600836-82600858 CAGTCACTAAAATATCATAATGG - Intergenic
914391503 1:147227127-147227149 TAGTCTTTAAAATATTTTACAGG - Intronic
916379037 1:164188332-164188354 AAGTGTTTAAAATATTTTAAAGG - Intergenic
919144052 1:193611089-193611111 CAGTCTTTAAAGTTTTTTAATGG - Intergenic
921592743 1:217023219-217023241 CCATTTCTGAAATATATTAATGG - Intronic
921712614 1:218387882-218387904 CCTTCTCTGAGATATTTGAAAGG + Intronic
924028122 1:239859150-239859172 CAGTCCATAAATTATTTTAATGG - Intronic
924199732 1:241646360-241646382 CCTTCTCTTAAATAGTTTGAAGG + Intronic
1065598683 10:27345935-27345957 AAGTCTCTACAATATTTTAAAGG + Intergenic
1065990115 10:31000862-31000884 CCCTCTCCAAAATCTTTTAGTGG + Intronic
1066111296 10:32199403-32199425 AGGTCTCTAAAATATTTAGAGGG - Intergenic
1066420655 10:35261698-35261720 CAATCTCTAAAAAAATTTAACGG + Intronic
1066562599 10:36686804-36686826 CCAAGTTTAAAATATTTTAAAGG - Intergenic
1067319312 10:45202656-45202678 AAGTCTCTACAATATTTTACAGG + Intergenic
1069924003 10:71835564-71835586 CAGTTTATAAAATATTTTTAGGG - Intronic
1070076577 10:73142357-73142379 ACATCTCTACAATATTTTTAAGG - Intronic
1071769496 10:88710090-88710112 TAGTCTTTAAAATAATTTAATGG + Intergenic
1072556569 10:96519847-96519869 CCTTTTCTAAAAGACTTTAAAGG + Exonic
1073499604 10:103923923-103923945 CCTTGTCTGAAATATTTCAATGG + Intergenic
1074658365 10:115620479-115620501 TTGTCTCTAAAATGGTTTAAGGG - Intronic
1079069617 11:17332715-17332737 CTGTCTCTAAAAAATTTAAAAGG - Intronic
1079753307 11:24225599-24225621 CCCTCTCTAAGAGACTTTAAGGG - Intergenic
1080018964 11:27538713-27538735 CCGTCTCTCAAATAAGTTCATGG + Intergenic
1080273437 11:30475269-30475291 CCTTCTCAAAAAAATTTTATTGG + Intronic
1081361192 11:42180613-42180635 CTGTCTCTGAAATACTTTTAGGG - Intergenic
1081843523 11:46221008-46221030 CTGTCTCTAAAATAAATAAATGG + Intergenic
1082198792 11:49337407-49337429 TCATGTCTAAAATGTTTTAAGGG - Intergenic
1085373181 11:76030936-76030958 CCTTGTCTGAAATATTTTCAGGG + Intronic
1086243023 11:84719576-84719598 CCTTTTCTGAAATATATTAATGG - Intronic
1086657019 11:89370692-89370714 TCATGTCTAAAATGTTTTAAGGG + Intronic
1086897235 11:92327464-92327486 GCGTTTTTAAAATATTTTAGAGG - Intergenic
1086939643 11:92782294-92782316 CTGTCTCTAAAAAAATTAAAAGG + Intronic
1088072586 11:105808494-105808516 CTTGATCTAAAATATTTTAATGG + Intronic
1090862737 11:130668940-130668962 CCTTGTTTAAAACATTTTAATGG + Intergenic
1091160612 11:133416301-133416323 CCCTCTCTAAAATTCTTTAATGG + Intronic
1094075380 12:26466941-26466963 CCATCTCTAATATCTTTGAAGGG - Intronic
1094560456 12:31548001-31548023 CAGCCTCTAAAAAGTTTTAAAGG + Intronic
1096345172 12:50840071-50840093 TTTTCTCTAAAAAATTTTAATGG + Intergenic
1098589367 12:72191638-72191660 ACGACAATAAAATATTTTAAGGG - Intronic
1098610674 12:72453635-72453657 AGGTCTCTAAAATACTTTCAAGG - Intronic
1101189703 12:102319170-102319192 CCATTTATAAAATATTTTTAAGG + Intergenic
1101226502 12:102693156-102693178 CAGTTTATAAAATATTTGAAGGG + Intergenic
1101744219 12:107526230-107526252 CCGGTTCTAAAATATTTCACGGG + Intronic
1103746633 12:123129261-123129283 CTGTCTCTAAAAAAATTAAATGG + Intronic
1103790853 12:123469802-123469824 CCCTCTCTAGGATATTTCAAGGG + Intronic
1104540452 12:129659672-129659694 CTTTCTGTAGAATATTTTAATGG + Intronic
1105220355 13:18320562-18320584 CAGTTTCTAATATTTTTTAAAGG - Intergenic
1105275621 13:18921521-18921543 CCGTGTGAAAAATATTTGAAAGG + Intergenic
1105812779 13:24009345-24009367 CACTCTGTAAAATATTTGAAGGG + Intronic
1107187276 13:37538406-37538428 TCAGCTCTAAAATGTTTTAATGG - Intergenic
1107656956 13:42601402-42601424 CTGTCTCTTAAAGATCTTAACGG - Intronic
1109475240 13:62872781-62872803 CAGTTTATAAAATATTTTATTGG + Intergenic
1109601606 13:64638210-64638232 CAGTCTGTAATAGATTTTAAAGG - Intergenic
1109621872 13:64920668-64920690 CCCTTTCTAAAATATATTCATGG - Intergenic
1109911756 13:68921409-68921431 CCTTTTCTGACATATTTTAAGGG + Intergenic
1111110156 13:83696974-83696996 ACGTTTATAAAATTTTTTAAGGG - Intergenic
1112669913 13:101623809-101623831 CTGACTGTAGAATATTTTAAAGG + Intronic
1116257876 14:42580710-42580732 TCATTTCCAAAATATTTTAAAGG - Intergenic
1116260428 14:42618047-42618069 ATGTTTCTAAAATATTTGAATGG - Intergenic
1117405953 14:55404193-55404215 TCATCTGAAAAATATTTTAAAGG + Intronic
1117917963 14:60698490-60698512 CTGTCTCTAACTTTTTTTAAAGG - Intergenic
1118946192 14:70389697-70389719 CCAACTCCAAAATTTTTTAAGGG - Intronic
1120514756 14:85457464-85457486 CCGCCTCTCAATTATTTTTATGG + Intergenic
1122618134 14:103035390-103035412 CACTCTCTAAAATATTTTTCAGG + Intronic
1202869955 14_GL000225v1_random:153205-153227 CAGTTTCTAATATTTTTTAAAGG - Intergenic
1126576550 15:50202881-50202903 CCAGCCCTAAAATATTTTAAAGG - Intronic
1129085861 15:73091111-73091133 CAGTCACTAAAAAATTGTAAAGG - Intronic
1131858960 15:96631088-96631110 TTTTCTATAAAATATTTTAAAGG + Intergenic
1134447507 16:14342176-14342198 CCATCTCTATTATTTTTTAAAGG - Intergenic
1134667257 16:16027806-16027828 CTGTCTCGAAAATATATTTAAGG + Intronic
1136097596 16:27968545-27968567 CCGGCCCTAAAACATTTTCATGG + Intronic
1139729407 16:68930037-68930059 CAGTCTCTATACTTTTTTAATGG + Intronic
1140379522 16:74473746-74473768 CCATTTTTAAAATATTTTAGTGG + Intronic
1140795922 16:78437744-78437766 CTGCTTCTAAAATATGTTAAAGG + Intronic
1141005094 16:80344591-80344613 CAGTCTCTAAAATGCTTTGATGG - Intergenic
1141209745 16:81966429-81966451 CTATTTCTAAAATATTTTTAGGG + Intergenic
1142931688 17:3290521-3290543 GCTTCTCTATAATATTTTATGGG - Intergenic
1144970581 17:19106755-19106777 CCGTCTCTAAAAAAATAGAAGGG + Intergenic
1144990884 17:19232917-19232939 CCGTCTCTAAAAAAATAGAAGGG + Intronic
1147398729 17:40165621-40165643 TCTTCTCTAATATATTTGAAAGG + Intronic
1150025351 17:61668557-61668579 CTGTCTCTAAAATATAAAAACGG - Intergenic
1150876096 17:68971986-68972008 CCGTCTTGAAAATATTCAAAGGG + Intergenic
1151809043 17:76425267-76425289 TGGTCACTAAAAAATTTTAAAGG + Intronic
1154423896 18:14257605-14257627 AGGTCTCTAAAATACTTTCAAGG - Intergenic
1154464018 18:14625598-14625620 ACATCTCTAAAATATTGTAATGG + Intergenic
1154996897 18:21649096-21649118 CCATCTCTAAAAAAAATTAAAGG - Intergenic
1155119892 18:22807630-22807652 CCTTCTCTAAAACATTTCACTGG - Intronic
1155436785 18:25820918-25820940 CCATGTCTACATTATTTTAAGGG - Intergenic
1158371825 18:56815133-56815155 TGGTCTTTAAAATATTTAAATGG + Intronic
1158448603 18:57543114-57543136 CCTTCTCAAAAAAATTTAAATGG - Intergenic
1158597989 18:58833084-58833106 CCGCCACTAAAATTTATTAATGG - Intergenic
1158754939 18:60311424-60311446 TCTATTCTAAAATATTTTAAAGG - Intergenic
1158977070 18:62718939-62718961 GAGTGTCTAAAATATTCTAATGG + Intronic
1159093655 18:63876924-63876946 CCCTCTCTAGAATATTTATAAGG + Intronic
1159173257 18:64800470-64800492 CCTTAACTAAAATATTTAAAAGG + Intergenic
1159855733 18:73585713-73585735 ACGTCTCTGAAATATATTAAAGG + Intergenic
1161318031 19:3627406-3627428 CCGTCTCTAAAATGGGTTGATGG - Intergenic
1161965773 19:7547640-7547662 CCGTCTCTAAAATAAATTAAAGG - Intronic
1162153043 19:8658943-8658965 CTCTCTCTAAAAAAATTTAAAGG + Intergenic
1162714110 19:12618502-12618524 CCGTCTCAAAAATAAAATAAAGG + Intronic
1167450116 19:49562441-49562463 CTGGCTCTAAATCATTTTAAGGG - Intronic
926569848 2:14517836-14517858 CCTGCTCTATAATTTTTTAAAGG - Intergenic
927373234 2:22382461-22382483 CAGACTTTAAAATATTTAAATGG - Intergenic
927610088 2:24529713-24529735 CTGTCTCTCAAATATTCTTATGG - Intronic
927664657 2:25022341-25022363 ACAGTTCTAAAATATTTTAAGGG - Intergenic
927668371 2:25048020-25048042 CTGTCTCTAAAATAAATAAAAGG - Intronic
927892835 2:26763216-26763238 CACACTCTAAAATATTTGAAGGG - Intergenic
930623998 2:53676200-53676222 AAGACTCTAATATATTTTAAAGG + Intronic
932128462 2:69166654-69166676 TCGTTAATAAAATATTTTAATGG - Intronic
932795707 2:74693683-74693705 CCTTTTCTGAAATATTTTCAAGG - Intergenic
935114226 2:100120805-100120827 CCATCTCTAACAAAATTTAAAGG - Intronic
935242411 2:101190137-101190159 ACCTCTTTAAAATATTTTACAGG - Intronic
935407918 2:102728506-102728528 TCCTCTATAAAATATTTTTAAGG + Intronic
935741004 2:106147832-106147854 CAAACTCTAAAATATTTTAGAGG - Intronic
935756003 2:106276452-106276474 CCGTGTCCAAAATCTTTTAAAGG + Intergenic
938311971 2:130297840-130297862 ACATCTCTAAAACATTGTAATGG + Intergenic
938313121 2:130307636-130307658 CCCTCTCTAATACATTTAAATGG + Intergenic
941219892 2:162764397-162764419 CTGTCTATAAAATATTATGAAGG - Intronic
941991173 2:171559087-171559109 ACCTCTTTAAAATATTTTACAGG - Intergenic
942343914 2:174981408-174981430 CTGTCTCAAAAATTTGTTAAAGG - Intronic
942740316 2:179168971-179168993 ATGTCTCTTAATTATTTTAATGG - Intronic
943708202 2:191058458-191058480 CGGTCTCTATGATACTTTAAAGG + Intronic
943973757 2:194444944-194444966 CCTTCTTTAGAATATTTTATAGG + Intergenic
944103896 2:196058757-196058779 CCATCTGTAGAATATTTTCAGGG - Intronic
945086918 2:206141242-206141264 CCATCTCTAAAAAATTAAAAAGG + Intronic
945158745 2:206866531-206866553 CCATCTCTAAATTATTTGGATGG + Intergenic
948015063 2:234682292-234682314 CATTCTCCAAAATATTTTATGGG + Intergenic
1168741264 20:193413-193435 AGGACTCTAAAATATTTTTAAGG - Intergenic
1169241103 20:3981815-3981837 CAGTCTTTAAAATATTCTATTGG + Intronic
1169624676 20:7551378-7551400 CCTTCTCTGAAAGATTTCAAGGG + Intergenic
1169799146 20:9497271-9497293 CTGTCTGTAAATTATTTTTAAGG + Intergenic
1170903030 20:20484579-20484601 CCATCTTTAAAATATATTCATGG - Intronic
1173270635 20:41531596-41531618 CCGTCTGTAAGGTATTTTATGGG + Intronic
1173600500 20:44291661-44291683 CCATCACTAAAATCTTTAAAAGG + Intergenic
1176810514 21:13532775-13532797 ACATCTCTAAAATATTGTAATGG - Intergenic
1176902583 21:14461165-14461187 AAGTCTGTAAAATATTTGAAGGG - Intergenic
1177033983 21:16019004-16019026 CTTTCTACAAAATATTTTAAAGG - Intergenic
1177364767 21:20119911-20119933 CCTTCTGTAAAATATCTTAAAGG + Intergenic
1177815571 21:25972696-25972718 CAGTCTCTAAGACATTTTAAAGG + Intronic
1178021824 21:28417031-28417053 CTATCTCTAAAATATTGCAAAGG + Intergenic
1182793830 22:32976055-32976077 AAGTGTTTAAAATATTTTAAGGG + Intronic
1184882112 22:47314239-47314261 ACGACTTTAAAAAATTTTAATGG + Intergenic
1185214788 22:49592438-49592460 CAAACTCTAAAATATTTGAAGGG - Intronic
951409975 3:22351472-22351494 CTGTCTGGAAAATACTTTAAGGG + Intronic
951955041 3:28244179-28244201 CCCTCTTTAAAAGATTCTAAAGG - Intronic
953047705 3:39310140-39310162 CTGGCTGTAAAATAATTTAATGG + Intergenic
954777206 3:53030443-53030465 CCCTGTTTAAAATGTTTTAAAGG + Intronic
954944886 3:54413678-54413700 CAGTCACTAAATGATTTTAATGG - Intronic
956423368 3:69108176-69108198 CACTCTCAAACATATTTTAAAGG - Exonic
956492106 3:69784003-69784025 TTGTCTCTAATATATTTGAAAGG - Intronic
956563432 3:70609871-70609893 ATGTCTCAAAACTATTTTAAGGG + Intergenic
956650195 3:71497883-71497905 TTTTCTCTAAAATATTTCAATGG - Intronic
957600529 3:82328485-82328507 CTGTCTCCTAAATATTTTGATGG - Intergenic
958892865 3:99800000-99800022 CCATGTCTAAAATATTATAAAGG + Intergenic
959351290 3:105267634-105267656 GCATCTGTAAAATTTTTTAAAGG + Intergenic
959672763 3:108997501-108997523 CTGTCTCAAAAAAATTTAAAAGG + Intronic
961196286 3:125004306-125004328 TCATCTCTAAAGTTTTTTAATGG + Intronic
961835278 3:129652992-129653014 ACCTCTTTAAAATATTTTACAGG + Intronic
962246032 3:133794369-133794391 CCCTCTATAAAATGTTTAAATGG - Intronic
964025422 3:152067935-152067957 CCATTTCTATATTATTTTAATGG + Intergenic
964260291 3:154827838-154827860 CCCTCTGTAAAATATTTGAAGGG + Intergenic
965851073 3:173025161-173025183 CAGTGTTGAAAATATTTTAATGG + Intronic
966571462 3:181448723-181448745 ATTTTTCTAAAATATTTTAATGG - Intergenic
967662004 3:192123708-192123730 CTGATTCTAAAATATTTTGATGG + Intergenic
968254814 3:197259152-197259174 CCCTCTCTAAATTTTTTTCATGG - Intronic
968710570 4:2113450-2113472 CTGTCCCTGAAATATTATAATGG - Intronic
970119993 4:12743083-12743105 CCTTCTTTAAAATATTTATATGG - Intergenic
970717379 4:18941890-18941912 ATGTCTTCAAAATATTTTAAGGG + Intergenic
971105636 4:23521515-23521537 CCACCTCTGAAATATTGTAATGG + Intergenic
971924442 4:32989122-32989144 CCGTGTTTTAAATATTTTAACGG + Intergenic
972968983 4:44548922-44548944 CTGTTTTTAATATATTTTAATGG + Intergenic
973075381 4:45918213-45918235 CCTTCTCTAATTTTTTTTAATGG + Intergenic
974645349 4:64683327-64683349 TCATGTTTAAAATATTTTAAGGG + Intergenic
974777978 4:66511752-66511774 AAATCTGTAAAATATTTTAAAGG - Intergenic
976127150 4:81845793-81845815 CAAACTCTAAAATATTTTGAAGG - Intronic
976865128 4:89716173-89716195 CATTCACTAAAATTTTTTAATGG - Intergenic
977045969 4:92070057-92070079 AGGTCTCTAAAATGTTTTCAAGG - Intergenic
977162351 4:93650882-93650904 ATGTATATAAAATATTTTAAGGG - Intronic
977560409 4:98527448-98527470 CCTTCACTGAAATATTTTTAGGG - Intronic
977839052 4:101679298-101679320 CAGTATCTTAAATATTTTTATGG + Intronic
978383850 4:108160366-108160388 CTGGCTCTAAAATATTTAACAGG + Intronic
980994279 4:139765533-139765555 CAGCCTCTGAAGTATTTTAAGGG + Intronic
981943236 4:150309522-150309544 CAATTTCTAAAATATTTTAAGGG + Intronic
983146226 4:164218004-164218026 CATTCTTTAAAATATTTTTAAGG + Intronic
987840611 5:23218694-23218716 ACATCTCTAAAATGTTTGAATGG - Intergenic
988198528 5:28040296-28040318 CCTTCTTTAAAAAATTTTTATGG + Intergenic
988637799 5:33005942-33005964 CAAACTCTAAAATATTTAAAGGG - Intergenic
990364608 5:55057614-55057636 CCCTCTATAGAATATATTAAAGG + Intergenic
990583467 5:57187137-57187159 CATTTTCTAAAATATTTTATAGG + Intronic
990750278 5:59007476-59007498 CTGCCTCTAAAATATTTTTAAGG - Intronic
991316573 5:65315330-65315352 CAGCAACTAAAATATTTTAAAGG + Intronic
992211129 5:74480496-74480518 CCATCTTTAAAATCTTCTAAAGG - Intergenic
993064799 5:83084221-83084243 CTGTCTTTAAAATAATTGAAAGG + Intronic
993752497 5:91688338-91688360 CTGTCTCTAAAGTATTTTCTTGG + Intergenic
993847899 5:92968078-92968100 CCTGCTCTAGAACATTTTAATGG + Intergenic
994203293 5:97003222-97003244 CTGTCTTAAAATTATTTTAAAGG - Intronic
994238772 5:97395535-97395557 TTGACTCAAAAATATTTTAAGGG + Intergenic
994469793 5:100188487-100188509 CTGTCTCTTAAATATTTTCTTGG + Intergenic
994735018 5:103542220-103542242 TTGCCACTAAAATATTTTAAAGG - Intergenic
994789559 5:104206388-104206410 CAGGCTCTAAAATATTCCAAAGG + Intergenic
994849668 5:105037912-105037934 GTGTCTTTAACATATTTTAAAGG - Intergenic
995351828 5:111185973-111185995 CAATCACTAAAATATTTTAATGG + Intergenic
996870992 5:128193104-128193126 ACGTCTCTAAAAAAATTAAAGGG + Intergenic
997149168 5:131473379-131473401 ACATTTCTAAAATATTTTAAAGG - Intronic
999464669 5:151791248-151791270 CTTTCTCTAAAATAGTTTAGTGG + Intronic
999576349 5:152982278-152982300 CCATCTCTAGAATAGTTTTATGG + Intergenic
999911330 5:156203649-156203671 CTGTCTATAAATTATTTTGAGGG - Intronic
1000669543 5:164043871-164043893 AGGGATCTAAAATATTTTAATGG - Intergenic
1002358713 5:178652522-178652544 CCGTCTTTAAAATAATAAAAGGG - Intergenic
1003195742 6:3912744-3912766 CCTGCTCGGAAATATTTTAATGG - Intergenic
1004055186 6:12129039-12129061 CCATTTCTATAAAATTTTAAAGG + Intronic
1004556231 6:16701137-16701159 CTGTATCTAAACTTTTTTAATGG - Intronic
1004751219 6:18564720-18564742 CTGTCTTTAAAATAATTTAATGG - Intergenic
1005631691 6:27714040-27714062 AAGTGTCTAGAATATTTTAAAGG + Intergenic
1007298120 6:40844107-40844129 CCTTCTCAAAATTATTTTCAGGG + Intergenic
1009700030 6:67164828-67164850 AAATTTCTAAAATATTTTAATGG - Intergenic
1009829053 6:68906141-68906163 CATTTTCCAAAATATTTTAATGG - Intronic
1011920368 6:92567710-92567732 CTTTCTGTAAAATATTTTTATGG - Intergenic
1012394224 6:98777456-98777478 CAGTCTCTAAATCATTTTCATGG + Intergenic
1013396194 6:109742914-109742936 CCTTCTTTATTATATTTTAATGG + Intronic
1013573661 6:111456189-111456211 CCGACTCTAAAATTACTTAAAGG - Intronic
1014589104 6:123240379-123240401 CCATTTCTAAAATAATTTATTGG - Intronic
1015898366 6:138038876-138038898 CCGTCTCTCAAAAAAATTAAGGG + Intergenic
1018716319 6:166535516-166535538 CATTCTCCAGAATATTTTAAAGG + Intronic
1018892615 6:167993386-167993408 CTGTTTCTTAAATACTTTAAGGG + Intergenic
1019569201 7:1701637-1701659 CCTTCTCTAAAAAAAATTAATGG + Intronic
1021158509 7:17242090-17242112 ATGTTTCTAAAATATTTCAAAGG - Intergenic
1021488098 7:21189029-21189051 CCAGCATTAAAATATTTTAAAGG - Intergenic
1021610704 7:22455158-22455180 CAGCCTTAAAAATATTTTAAAGG + Intronic
1022549109 7:31220239-31220261 CTGTCACCAAAATATTTCAATGG + Intergenic
1023166832 7:37351121-37351143 CTGTCTCTAAATTTTTATAAAGG - Intronic
1023769692 7:43545091-43545113 CCATCTCTAAAAATTTTTAAAGG + Intronic
1024894389 7:54240588-54240610 CCCTCACAAAAATATTTTACAGG - Intergenic
1025078075 7:55960467-55960489 CCGTCTCTAAAATATTTTAAAGG + Intronic
1027186365 7:75973316-75973338 CTGTCTCTAAAATAAAATAAAGG - Intronic
1027515284 7:79135029-79135051 ATGTCTCTAAATTATATTAAAGG - Intronic
1028087517 7:86654321-86654343 CACTCTCCCAAATATTTTAATGG + Intronic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1031468333 7:122141186-122141208 CCCTCTATAAAATACTTTACTGG + Intronic
1032541867 7:132709796-132709818 CCATCTCTAGAATACTTTTAAGG + Intronic
1032986990 7:137347933-137347955 CCCTCTCTGAAATATTTGAAAGG + Intergenic
1033187932 7:139246361-139246383 CCGTCTCAAAAAAAATTTGAGGG + Intronic
1033364400 7:140660506-140660528 CTGTTTCTAAAATACTGTAAGGG - Intronic
1034388922 7:150767125-150767147 AGGTCTCCAAAATATTTTTAAGG + Intergenic
1037270434 8:17123793-17123815 TGATCTGTAAAATATTTTAATGG + Intergenic
1038080383 8:24128369-24128391 CTGTCCCTAAAAGATTTGAAAGG - Intergenic
1038512326 8:28150854-28150876 CTGTCTCTAAAATAAATAAAAGG - Intronic
1039190134 8:34964201-34964223 CCCTCTTTAAAATATCTAAATGG - Intergenic
1040034257 8:42853292-42853314 ACATATCTAAAACATTTTAAAGG - Exonic
1041984407 8:63904392-63904414 CGGTCTGCAGAATATTTTAAAGG - Intergenic
1042003734 8:64156994-64157016 ACATCTTTAAAATTTTTTAAAGG + Intergenic
1043707264 8:83366741-83366763 CCTTCACTAAATTATCTTAATGG - Intergenic
1043824180 8:84904970-84904992 CCATCTTTAAAACATTTTAAGGG + Intronic
1044929544 8:97238686-97238708 CATTCTCACAAATATTTTAAGGG + Intergenic
1045658497 8:104411554-104411576 CCCTCTCCAAAATTTCTTAAAGG - Intronic
1047066030 8:121284168-121284190 CCAGCTCTAAACTATTTTTATGG - Intergenic
1050672868 9:8017590-8017612 CTGTATTTAAAATATTTTCAAGG - Intergenic
1052607261 9:30721662-30721684 CCCTCTCAAACATATTTTTATGG - Intergenic
1054897607 9:70331271-70331293 CAGTTTCTAAAATACTTTCAAGG + Intronic
1054981888 9:71216686-71216708 CCTTCTCTAAAAGAATTTACAGG - Intronic
1055934683 9:81593497-81593519 CTGTATGTAAAATTTTTTAAGGG + Intronic
1058219284 9:102276839-102276861 ACGTCTCAAAAGCATTTTAAAGG + Intergenic
1058269595 9:102954085-102954107 CTCTCTCTAAAATGTTTGAATGG + Intergenic
1058531872 9:105913999-105914021 CAAACTCTAAAATATTTTGAAGG - Intergenic
1058565425 9:106279291-106279313 CCCCCTTTAAAATTTTTTAAGGG - Intergenic
1203734497 Un_GL000216v2:123340-123362 CAGTTTCTAATATTTTTTAAAGG + Intergenic
1186177780 X:6943350-6943372 TAATATCTAAAATATTTTAAAGG + Intergenic
1186629933 X:11337907-11337929 CCTTCTCAGACATATTTTAATGG - Intronic
1188382429 X:29511885-29511907 GGGACTCTAAAATATGTTAATGG - Intronic
1188861032 X:35256586-35256608 CCTCCTCTAAATTATCTTAAAGG - Intergenic
1189570358 X:42288907-42288929 CCTGCTCTAAAATAAATTAAAGG - Intergenic
1190568831 X:51761359-51761381 CATTCTCTAAAATTTTATAATGG - Intergenic
1194465919 X:94235365-94235387 CAGCCTTTAAAATATTTTCAAGG + Intergenic
1194822266 X:98524106-98524128 TCCTCTTTAAAATATTTTATAGG + Intergenic
1194957047 X:100193094-100193116 CTCTTTTTAAAATATTTTAAAGG + Intergenic
1195256515 X:103096248-103096270 CAAACTCTAAAATATTTAAAGGG - Intergenic
1195669233 X:107455252-107455274 CCGTCTCTAAAATACATTTGGGG + Intergenic
1199187649 X:144936058-144936080 TTGTGTCTAAAAGATTTTAAAGG - Intergenic
1199252927 X:145685198-145685220 GCATCTCCAAAAAATTTTAATGG + Intergenic