ID: 1025078763

View in Genome Browser
Species Human (GRCh38)
Location 7:55964743-55964765
Sequence CGCCGCGAGGCGGAGGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 316}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025078740_1025078763 28 Left 1025078740 7:55964692-55964714 CCAGGCTCCGGTGAGCAGCGCCG 0: 1
1: 0
2: 4
3: 15
4: 134
Right 1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 316
1025078739_1025078763 29 Left 1025078739 7:55964691-55964713 CCCAGGCTCCGGTGAGCAGCGCC 0: 1
1: 0
2: 2
3: 13
4: 148
Right 1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 316
1025078745_1025078763 8 Left 1025078745 7:55964712-55964734 CCGCCCTTCCCGGGAGGTGCCGG 0: 1
1: 0
2: 2
3: 38
4: 454
Right 1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 316
1025078749_1025078763 5 Left 1025078749 7:55964715-55964737 CCCTTCCCGGGAGGTGCCGGGGA 0: 1
1: 0
2: 1
3: 18
4: 140
Right 1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 316
1025078741_1025078763 21 Left 1025078741 7:55964699-55964721 CCGGTGAGCAGCGCCGCCCTTCC 0: 1
1: 1
2: 0
3: 16
4: 134
Right 1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 316
1025078755_1025078763 -1 Left 1025078755 7:55964721-55964743 CCGGGAGGTGCCGGGGAGGGGCC 0: 1
1: 0
2: 4
3: 66
4: 503
Right 1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 316
1025078750_1025078763 4 Left 1025078750 7:55964716-55964738 CCTTCCCGGGAGGTGCCGGGGAG 0: 1
1: 0
2: 2
3: 22
4: 190
Right 1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 316
1025078754_1025078763 0 Left 1025078754 7:55964720-55964742 CCCGGGAGGTGCCGGGGAGGGGC 0: 1
1: 0
2: 9
3: 112
4: 700
Right 1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025078763 Original CRISPR CGCCGCGAGGCGGAGGGCGC GGG Intronic
900558610 1:3292456-3292478 CGCAGCCAGGCGGAGAGCGACGG - Intronic
901007677 1:6179767-6179789 CGCCGCGCGGCCAAGGGCGAAGG - Intronic
902410060 1:16207132-16207154 CAGCGCGAGGAGGAGGGCCCGGG - Exonic
902586177 1:17439744-17439766 CGCGGCGGGGCGGGAGGCGCGGG + Intergenic
902641739 1:17770929-17770951 CGCTGTGAGGCTGGGGGCGCGGG + Intronic
903263301 1:22142752-22142774 CGGCGCGGGGCAGCGGGCGCGGG - Intronic
903986776 1:27234580-27234602 GGCTGCGAGGCGCAGGGCGGAGG + Exonic
904528932 1:31155350-31155372 CCCGGAGAGGGGGAGGGCGCAGG + Intergenic
905037916 1:34929600-34929622 CGCCGAGCGGCAGCGGGCGCGGG + Intergenic
905179143 1:36155993-36156015 CGCCGGGAGGCTGCGGGCGCGGG + Intronic
905449321 1:38046749-38046771 GGCGGCGCGGCGCAGGGCGCGGG - Exonic
905685190 1:39902380-39902402 CGCCGCGAGGGGTAGGGGGAGGG + Intergenic
905960092 1:42035909-42035931 CGTGGCGCGGCGGCGGGCGCGGG + Intronic
905995940 1:42380709-42380731 CAGCGCGCGGCGGCGGGCGCTGG - Intergenic
906640598 1:47438489-47438511 CGCGGCGACGCGGAGCCCGCTGG + Exonic
912435110 1:109656268-109656290 CGCAGCGGGGCCGAGGGGGCGGG + Exonic
912682577 1:111738740-111738762 CGCGGGGAGGAGGAGGGTGCTGG - Intronic
915589172 1:156860936-156860958 TGCTGCGAGGCGGACGGCGCGGG + Exonic
915902091 1:159854705-159854727 CCCAGCCAGGAGGAGGGCGCGGG - Exonic
916179146 1:162069541-162069563 CGTCGCGCGGCCGGGGGCGCGGG + Intergenic
917131012 1:171742089-171742111 TGGCGCCAGGCGGAGGGGGCGGG + Exonic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
920698585 1:208200666-208200688 AGCCGGGAGGCGGAGGTTGCAGG - Intronic
922739382 1:228006912-228006934 CGGCGCGGGGCGGCGGGGGCGGG - Intergenic
923055881 1:230425889-230425911 GGGCGCGCGGAGGAGGGCGCCGG - Intergenic
923674131 1:236065274-236065296 GGCCGCGAGGGGGAGGGCGAGGG + Intergenic
924778405 1:247126827-247126849 AGCCGCGGGGCTGCGGGCGCGGG - Intronic
924783253 1:247171593-247171615 AGCCGCGGGGCTGCGGGCGCGGG + Intronic
924957632 1:248944760-248944782 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
1063636465 10:7787733-7787755 GGACGCGGGGCTGAGGGCGCGGG - Intronic
1064123544 10:12639406-12639428 ACCCGCGAGGCGGAGGTTGCAGG + Intronic
1064208872 10:13347493-13347515 CGGCGGGAGGCGGCGGGAGCCGG + Intronic
1065093044 10:22253244-22253266 CGCTGCGGGGCTGAGGGCACTGG - Intergenic
1066464405 10:35640348-35640370 GGCGGCGCGGCGGCGGGCGCGGG - Exonic
1066758043 10:38730227-38730249 GGGCGCGAGGCGGGGTGCGCGGG + Intergenic
1066963649 10:42242481-42242503 GGGCGCGAGGCGGGGCGCGCGGG - Intergenic
1074509724 10:114101248-114101270 CGGCGCGAGGCGGGGAGCCCAGG - Intergenic
1074585980 10:114768163-114768185 CACCGGGAGCCGGAGGGGGCCGG - Intergenic
1076372285 10:129963564-129963586 CGCCGGCCGGCGGAGGGGGCCGG + Intronic
1076963475 10:133786278-133786300 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
1076963522 10:133786479-133786501 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
1076963529 10:133786508-133786530 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
1079251595 11:18791465-18791487 AGCCGGAAGGTGGAGGGCGCGGG - Intronic
1080503653 11:32892781-32892803 GGCCGCGGGGCGGAGGGGGGCGG + Intergenic
1081587415 11:44396928-44396950 GGCAGCGAGGCTGAGGGTGCTGG - Intergenic
1083234735 11:61344140-61344162 AGCCTCGAAGCGGATGGCGCTGG + Exonic
1083610179 11:64000648-64000670 CTCCGGGAGGCGGGGGCCGCCGG + Intronic
1083925551 11:65803969-65803991 CGGGGAGAGGCGGAGGGAGCCGG - Intergenic
1084310307 11:68312798-68312820 CGCCGCGGGTAGGTGGGCGCAGG + Exonic
1084888457 11:72224925-72224947 CGTCTCGGGGCGGATGGCGCGGG + Exonic
1085322522 11:75583649-75583671 CGCCGCGAGGGGCAGGGAGTCGG - Intergenic
1087175295 11:95090176-95090198 CGCCGCCGGGCGCAGGGCGCGGG - Exonic
1088462241 11:110093524-110093546 GGGCGCCAGGCGGAGGGCGCCGG + Intronic
1089700212 11:120240102-120240124 CGGCGCGGGGCGGGGGCCGCCGG - Intronic
1091238563 11:134037387-134037409 CGCCGCGGAGGGGAGGGCGGTGG + Intergenic
1092163649 12:6329679-6329701 CCACGAGAGGCGGAGGGCGCGGG - Intronic
1092176088 12:6408317-6408339 ACCCGGGAGGCGGAGGTCGCAGG - Intergenic
1092348599 12:7737152-7737174 CCCCGGGAGGCGGAGGCTGCAGG + Intronic
1092462340 12:8697842-8697864 CGCCGCGGCGCGGCGGGCGGGGG - Intronic
1092537961 12:9404599-9404621 CACCGCGAGGCGGGGGGGGGGGG + Intergenic
1093435250 12:19129484-19129506 CTTCGCGCGGCGGAGGGGGCGGG + Intergenic
1094470278 12:30796235-30796257 GGCCGCGGGGCGGCGGGGGCGGG - Intergenic
1095958603 12:47819910-47819932 GGCCGGGAGGGGGAGGGCCCTGG + Intronic
1096309200 12:50505268-50505290 CGCCGCGATCCGCAGGGCCCCGG - Intronic
1096460724 12:51820429-51820451 CGGCGCGCGGGGGAGGCCGCGGG - Intergenic
1096634331 12:52948996-52949018 CGGCCCGGGGCGGAGGGCGCGGG + Exonic
1096708929 12:53441520-53441542 CGGGGCTAGGCGGAGAGCGCTGG - Intergenic
1096992639 12:55817732-55817754 CTCCTGGAGGCGGAGGCCGCGGG - Exonic
1097218146 12:57430498-57430520 GGGCGCGGGGCGGAGGGCGGCGG - Intronic
1098029051 12:66235417-66235439 CGCCGCGCGGCGGCGGCCGGCGG + Intronic
1101494001 12:105236295-105236317 CCCCGCGAGCCGGCGAGCGCAGG - Intronic
1101592972 12:106139426-106139448 CGCCGCGAGCCGGGGGCCGCCGG + Exonic
1102204719 12:111082708-111082730 CGCCGGGAGGTGGAGGAGGCAGG + Intronic
1102474351 12:113179185-113179207 CGGCGAGAGGATGAGGGCGCGGG + Exonic
1102933820 12:116881127-116881149 CGCGCGGAGCCGGAGGGCGCCGG - Exonic
1103595504 12:122022423-122022445 GGCCCGGAGGCGGCGGGCGCCGG + Intronic
1103604788 12:122078715-122078737 CGGCGGGAGGGGGAGGGCTCCGG - Exonic
1104568209 12:129903689-129903711 CGCCTCCAGGCGCAGGGCTCCGG + Intergenic
1104841585 12:131828437-131828459 GAACGCGAAGCGGAGGGCGCGGG + Exonic
1104980057 12:132569718-132569740 CCCCGCCCGGCGGAGGGAGCTGG - Intronic
1105240892 13:18609245-18609267 CACCGGGAGGCGGCCGGCGCGGG - Intergenic
1105957852 13:25301094-25301116 CTCCGCGAGGCCTGGGGCGCAGG + Intergenic
1106510473 13:30408511-30408533 AGGCGCGAGGAGGAGGGGGCGGG + Intergenic
1107534118 13:41311462-41311484 CCCCGCGAAGCGGAGCGCCCGGG + Exonic
1108221084 13:48233553-48233575 CGCCCCGAGGTGGCGGGCGCGGG + Intronic
1109858833 13:68171148-68171170 CTCCGCGCGGGGCAGGGCGCGGG + Intergenic
1110318585 13:74135515-74135537 CGCGGCGGCTCGGAGGGCGCGGG + Intergenic
1110775659 13:79405845-79405867 CGGCGCGCGGAGGAGGGGGCGGG - Exonic
1111220943 13:85205183-85205205 CACCACGGGGCGGGGGGCGCTGG - Intergenic
1113472631 13:110557792-110557814 GGCCGGGAGGCGGGGGGAGCAGG - Intronic
1113578311 13:111410291-111410313 CGCGGTGCGGCGGAGGGCCCTGG - Intergenic
1113914805 13:113863873-113863895 CGGCGCGCGGCGCAGGGCGGCGG + Exonic
1113914874 13:113864098-113864120 CGCGGGGAGGCGGCGGGGGCGGG + Intergenic
1113989910 13:114353119-114353141 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
1114323471 14:21566645-21566667 GGCCGCGGGGCGGAGGGGGTGGG + Intergenic
1114473726 14:22980730-22980752 CGCCGCGCGGCGGAGGGGTGGGG - Intronic
1115320741 14:32077122-32077144 CCCGGCGCGGCGGCGGGCGCTGG + Intronic
1119296561 14:73537824-73537846 CGGCGCGAGCCGGTGCGCGCGGG + Exonic
1119306638 14:73612974-73612996 CGGCGCGAGCCGGTGCGCGCGGG + Intronic
1120168066 14:81221048-81221070 CGCGCCGGGGCGGAGGCCGCCGG + Intronic
1120521754 14:85533410-85533432 CGCTGCGCGGGGGCGGGCGCAGG - Intronic
1120765446 14:88323572-88323594 CGGCGGGAGGCGGTGGGCGGTGG + Intronic
1121776180 14:96592675-96592697 CGGCGCGGGGCGGAGGGCAGGGG - Intergenic
1122082395 14:99274636-99274658 TGCCGCGAGGTGGAGCGCGCCGG - Intergenic
1122445064 14:101761935-101761957 GGCCGCGGGACGGAGGGAGCAGG + Intronic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1123004442 14:105314656-105314678 CGGCGCGGGTCGGAGGGCGCCGG + Exonic
1123168518 14:106349217-106349239 TGCAGGGAGGCGGAGGGGGCGGG - Intergenic
1123222836 14:106872764-106872786 CGCAGGGAGGCGGAGGGGGCGGG - Intergenic
1123490465 15:20775894-20775916 CACCGGGAGGCGGCCGGCGCGGG + Intergenic
1123546966 15:21344981-21345003 CACCGGGAGGCGGCCGGCGCGGG + Intergenic
1123722101 15:23068960-23068982 ACCCGGGAGGCGGAGGCCGCGGG - Intergenic
1123753141 15:23373795-23373817 ACCCGGGAGGCGGAGGCCGCAGG + Intergenic
1124696752 15:31870327-31870349 CGCGGGGACGCGGGGGGCGCGGG - Intronic
1127606497 15:60592421-60592443 AGCCGCGGTGCGGAGAGCGCAGG + Intronic
1128161107 15:65423140-65423162 CCCCGCGAGGCGCAGGGCCGTGG - Intergenic
1131888644 15:96948011-96948033 CGCGGGGAGGCGGGCGGCGCGGG - Intergenic
1202955297 15_KI270727v1_random:72197-72219 CACCGGGAGGCGGCCGGCGCGGG + Intergenic
1133053895 16:3135195-3135217 CGCCCCGAGGCAGAGGCCGGAGG + Exonic
1134121290 16:11586714-11586736 CGAGGCGCGGCGGAGGGCGTGGG - Intronic
1136220044 16:28823060-28823082 CGCCGCGAGGCGGAAGGGGAGGG - Intronic
1136419550 16:30123226-30123248 CGCCGTGGGGAGGAGGGCGGTGG - Exonic
1136843137 16:33555045-33555067 GGGCGCGAGGCGGGGCGCGCGGG - Intergenic
1137426339 16:48384716-48384738 CGCCGCGGGGAGGAGGGGGAGGG + Intronic
1137531601 16:49281878-49281900 GGCCGGGAGGCGGCGGGGGCGGG - Intergenic
1138105345 16:54284776-54284798 CGCCGGGAGGCGAGCGGCGCGGG + Exonic
1138105890 16:54286994-54287016 CGGCGCGAGCAGGAGGGGGCGGG - Intergenic
1138327955 16:56191299-56191321 CCCCGGGACGGGGAGGGCGCGGG - Intergenic
1141452734 16:84116684-84116706 CGCCGCTAGGCGGAGCGGGTCGG + Intronic
1141585016 16:85027969-85027991 CGCCGTGGGGCGAGGGGCGCGGG + Intronic
1141694218 16:85612227-85612249 CGCCGCGATGGGGTGGGGGCGGG + Intronic
1141770372 16:86086068-86086090 CACAGCAAGGCGGAGGGAGCTGG + Intergenic
1141959177 16:87392781-87392803 CACCCCGCCGCGGAGGGCGCGGG - Intronic
1203122913 16_KI270728v1_random:1554946-1554968 CGCAGAGAGGCGCACGGCGCTGG - Intergenic
1203153302 16_KI270728v1_random:1855343-1855365 GGGCGCGAGGCGGGGCGCGCGGG - Intergenic
1142852604 17:2711517-2711539 GGCCGCTGGGCGGGGGGCGCCGG - Intronic
1143411862 17:6713876-6713898 GCCCGCGGTGCGGAGGGCGCGGG - Intergenic
1143452405 17:7043643-7043665 TGGCGCGGGGCGGAGGGAGCCGG + Exonic
1143629056 17:8126686-8126708 CGGTGGGAGGCGGAGCGCGCCGG - Intergenic
1143750282 17:9022252-9022274 CGCCGAGAGCTGGAGGGCGCGGG + Intronic
1145041373 17:19580158-19580180 CGCCGCGCAGGGGTGGGCGCGGG + Intergenic
1145110324 17:20156301-20156323 CGCCGCGAGCCGGAGGCGGTGGG - Intronic
1145962819 17:28897411-28897433 CACCGCGCGGCGCAGGGCGCTGG - Intronic
1146022635 17:29292894-29292916 GGCCGCGGTGCGGGGGGCGCCGG + Intronic
1146058621 17:29593291-29593313 CGCCGCTCGGCGGAGGGAGCAGG - Intronic
1146197373 17:30824827-30824849 AGCCGCGGGGCGGGCGGCGCTGG - Intergenic
1147313484 17:39607852-39607874 CTCCTCAAGGCGGCGGGCGCCGG + Exonic
1147629184 17:41919004-41919026 CGCCGCGAGCCGATGGGGGCGGG - Intronic
1150326693 17:64263338-64263360 CGCCGCCAACCAGAGGGCGCGGG + Intergenic
1150840484 17:68601416-68601438 CCGAGCGAGGGGGAGGGCGCAGG - Intergenic
1151472286 17:74325947-74325969 CGCCGCGAGCAGAGGGGCGCGGG + Intergenic
1151783854 17:76265670-76265692 CGCCGGGCGGCGGCGGGGGCGGG + Intronic
1152345493 17:79748366-79748388 CGGCGAGGGGCGGAGGGCCCGGG - Intergenic
1152551557 17:81032912-81032934 AGCCGCCGGGCGGAGGGAGCAGG + Intergenic
1152617832 17:81346025-81346047 GGCCGCGGGGCGCGGGGCGCTGG - Intergenic
1152625630 17:81386838-81386860 CGCCGGGGGGCGGAGGGAGGGGG + Intergenic
1152697502 17:81804323-81804345 CGCGGCGGGGCCGGGGGCGCGGG + Intronic
1153515235 18:5895634-5895656 CGGCGGGCGGCGGAGGACGCGGG - Intronic
1153515278 18:5895739-5895761 GGCCGCGGGGCAGGGGGCGCGGG + Intronic
1153994104 18:10424739-10424761 CGCAGTGGGGCGGAGGGTGCCGG + Intergenic
1154448078 18:14450663-14450685 CACCGGGAGGCGGCCGGCGCGGG + Intergenic
1154954919 18:21243490-21243512 CGCCTCGAGGCGGGGGGAGGCGG - Intronic
1155392098 18:25349601-25349623 GGCCGGGAGGCGTGGGGCGCCGG + Intronic
1156253823 18:35376958-35376980 CGGCGCGGCGCGGTGGGCGCGGG - Intronic
1156324996 18:36067157-36067179 CGCCGGGAAGCCGGGGGCGCTGG + Intronic
1156473957 18:37394234-37394256 AGGGGCGGGGCGGAGGGCGCGGG + Intronic
1160590322 18:79940976-79940998 CGCCACGAGGGGTAGGGGGCCGG - Intronic
1160653461 19:246732-246754 CGCCGCTGGGCGGGGAGCGCGGG + Intergenic
1160844424 19:1160166-1160188 GGCAGCGAGGCTGAGGGAGCGGG + Intronic
1160851408 19:1194664-1194686 GGCCGCCAGGTGGCGGGCGCGGG - Intronic
1161327564 19:3670963-3670985 CGCGGCGGGGCGGAAGGTGCTGG + Intronic
1161333851 19:3700492-3700514 CGGCGCGGGGCGGACGGGGCGGG + Intergenic
1162067271 19:8133525-8133547 ACCCGCGAGGCGGAGGTTGCAGG - Intronic
1162778686 19:12995721-12995743 CGCAGCGCGGCGGAGGCCGGAGG + Exonic
1162911037 19:13847840-13847862 CGCCGGCAGGGGGAGGGGGCGGG - Intergenic
1163442480 19:17328812-17328834 GGCGGCGGGGCGCAGGGCGCCGG + Exonic
1163842249 19:19618583-19618605 CGCCGCGGGGCGGGGGGCGATGG + Exonic
1166083118 19:40457559-40457581 CTCCGGGAGGCGGAGGTTGCAGG + Intronic
1166126318 19:40717218-40717240 CGCCGCGAGGAGGGCGGCGGCGG + Exonic
1166367138 19:42283730-42283752 CGCCGCGCTGCGGAGGTCTCTGG - Intronic
1167643822 19:50695384-50695406 CGCCGGGCGGCGGAGGGGGCCGG + Intronic
1168336542 19:55600411-55600433 ACCCGAGAGGCGGGGGGCGCAGG + Intronic
925725246 2:6865505-6865527 CGCCGCCAGGCGGGGGTCGGGGG + Exonic
926077254 2:9951511-9951533 CGGCGCGGGGCGGGGGGCGGGGG - Intergenic
926089871 2:10043188-10043210 GGCGGCGGGGCGGAGGGGGCGGG - Intronic
926095631 2:10079645-10079667 CACCCCTAGGCGGAGCGCGCCGG - Intronic
926282993 2:11465705-11465727 CGGCGCGGGGAGGAGGGGGCCGG + Intronic
927851704 2:26503726-26503748 CGCCGCGAGGCGCGGGGCTGCGG + Intronic
929033680 2:37671725-37671747 TGGGGCGGGGCGGAGGGCGCGGG + Exonic
929537507 2:42792778-42792800 CGCGGAGAAGCAGAGGGCGCGGG - Intergenic
929548716 2:42875375-42875397 CGCCGGGAGGAGGAGGGAGCTGG - Intergenic
932410842 2:71546839-71546861 TGCCGAGAGGCAGAGGGAGCTGG + Intronic
935645312 2:105329630-105329652 CGGCGCGGGACGGCGGGCGCCGG - Exonic
936569893 2:113603972-113603994 CGCCGCCGGGCGGGGAGCGCGGG + Intergenic
938414505 2:131093245-131093267 CGCCGCGGGCCGGCGTGCGCTGG - Intronic
941020967 2:160407658-160407680 CGCCGCGCGGCGGCGGCCGGCGG + Intronic
943069574 2:183124689-183124711 CGCCGGGAAGCTGAGGGCCCTGG + Intronic
946394258 2:219435266-219435288 CGCTGCGGGGCGCAGGACGCCGG + Exonic
948479258 2:238239974-238239996 CGCGGGGCAGCGGAGGGCGCCGG - Exonic
949088871 2:242182369-242182391 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
949088916 2:242182570-242182592 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
949088923 2:242182599-242182621 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
949088930 2:242182628-242182650 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
949088937 2:242182657-242182679 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
949088944 2:242182686-242182708 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
949088951 2:242182715-242182737 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
949088958 2:242182744-242182766 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
1169143556 20:3238931-3238953 AGCCGCGGGGAGGAGGGCGCGGG - Intronic
1169214740 20:3786525-3786547 CGCCCCGGGGCGGGGGGCCCGGG + Exonic
1169345124 20:4823234-4823256 CGGCGCAAGGTGCAGGGCGCGGG - Intronic
1171567772 20:26209669-26209691 CCCCGCGAGGCAGAAGGCGGGGG + Intergenic
1172284644 20:33732143-33732165 GGCCGCGGGGCGGAGGGCGCCGG + Intronic
1172702892 20:36863589-36863611 CGCGGCGAGGCCGAGGGGGCGGG - Exonic
1172793448 20:37521568-37521590 CAGCGCGAGGAGGACGGCGCAGG - Intronic
1173603335 20:44311295-44311317 GGCCACGAGGGGGAGCGCGCGGG - Intergenic
1173930142 20:46811340-46811362 GGCGGCGGGGCGGAGGGCGGGGG - Intergenic
1174287737 20:49484105-49484127 CTCTCCGAGGCGGGGGGCGCCGG + Intergenic
1174736675 20:52972113-52972135 CTCCGGGAGGCGGAAGGGGCGGG - Intergenic
1175240129 20:57541071-57541093 AGGCACGAGGCGGAGGGCTCTGG + Intergenic
1175267134 20:57709741-57709763 CGCCGCGGGGCTCAGTGCGCGGG + Exonic
1175994197 20:62805066-62805088 CGCAGCCGGGCGGGGGGCGCCGG - Intronic
1176029922 20:63006938-63006960 AGCCGCGACGCGCAGGGGGCGGG + Exonic
1176181577 20:63752044-63752066 CACCCCGAGGCGCAGGGTGCAGG - Intronic
1176194395 20:63830826-63830848 CGGCGCGGGGCGGGGCGCGCGGG - Intronic
1176221197 20:63970003-63970025 CTCCGCGACGGGGAGGGGGCGGG + Intronic
1176448155 21:6840030-6840052 CACCGGGAGGCGGTCGGCGCGGG - Intergenic
1176826325 21:13705052-13705074 CACCGGGAGGCGGTCGGCGCGGG - Intergenic
1179674837 21:42974447-42974469 CCCTGCGCGGCGGCGGGCGCGGG - Intergenic
1180109751 21:45642513-45642535 CGCCCCGAGGACCAGGGCGCTGG - Intergenic
1180264094 21:46698651-46698673 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
1180614885 22:17120655-17120677 AGCCGCTCGGCGGGGGGCGCGGG - Exonic
1180801587 22:18634480-18634502 CGCGGCGCGGGGGACGGCGCGGG - Intergenic
1180852830 22:19030019-19030041 CGCGGCGCGGGGGACGGCGCGGG - Intergenic
1181096377 22:20507840-20507862 CGCCGGGAGACAGAAGGCGCCGG + Intronic
1182123561 22:27801254-27801276 GGCTGCGAGGCGGCAGGCGCCGG + Exonic
1182211369 22:28679914-28679936 GGGCGCGAGGCGGGGCGCGCGGG - Intergenic
1183441397 22:37825032-37825054 CGAGGCGCGGCGGAGGGCGACGG + Exonic
1184276503 22:43412031-43412053 CGCGGCGAGGCGGCCGCCGCCGG + Intronic
1184620299 22:45671812-45671834 CGCCGCGGGGGAGGGGGCGCCGG - Exonic
1185189565 22:49426259-49426281 AGCCGGGAGGCGGGGGGTGCAGG - Intronic
1185313933 22:50170695-50170717 CGCGGCCCGGCGGGGGGCGCGGG - Intergenic
1185430332 22:50807032-50807054 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
951485205 3:23202971-23202993 GGCCGCGAGGGGGCGGGGGCGGG - Intergenic
954063650 3:48088994-48089016 CGTGGCGAGGGGGAGGGCGGAGG + Exonic
954689537 3:52388397-52388419 TGCTGTGGGGCGGAGGGCGCAGG - Exonic
955916483 3:63912638-63912660 CGCCGCGCGGCGGCGGCGGCGGG + Exonic
960914383 3:122681259-122681281 CGCCTGGAAGCGCAGGGCGCCGG - Intronic
961446287 3:126983207-126983229 CGCGGCGGGGCGGACGGCGGCGG + Intergenic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
964790585 3:160450350-160450372 AGCTGAGCGGCGGAGGGCGCAGG - Intronic
964801551 3:160564783-160564805 CGCCGCGGGAAGGAGGGCGGTGG - Intronic
966592306 3:181696179-181696201 CACCGGGAGGCCGAGGGCTCGGG + Intergenic
966915766 3:184583485-184583507 GGCCGCGCGGAGGAGGCCGCGGG + Intronic
968085915 3:195873814-195873836 GGCGGGGAGGCGGGGGGCGCGGG + Intronic
968221390 3:196942662-196942684 CGCCGCGGGGCGGAAGACGAGGG + Intergenic
968434115 4:576216-576238 CGGCGGGAGGCGGAGGATGCGGG - Intergenic
968583624 4:1406060-1406082 CGTCCCGAGGCGGCGGGTGCAGG + Exonic
968701406 4:2059701-2059723 CACGGCGGGGCGGGGGGCGCGGG + Exonic
968756386 4:2418356-2418378 CGCAGCGCTGCGGAGGGCGAGGG - Exonic
968879835 4:3293177-3293199 GGCCGGGAGGCGGAGGGCGCGGG - Intronic
969491143 4:7499887-7499909 GGCCGTGAGGAGGAGGGTGCTGG + Intronic
969829257 4:9781866-9781888 CGCCGGGCTGCGGAGCGCGCGGG - Exonic
971244146 4:24913124-24913146 GGTCGCGGGGCTGAGGGCGCGGG - Intronic
972396485 4:38663622-38663644 CGAGCCGAGGCGGGGGGCGCGGG - Intergenic
980969480 4:139555863-139555885 CTCCGCCAGGCCGGGGGCGCTGG - Intronic
981782666 4:148444881-148444903 CGCTGCGGAGCGGCGGGCGCGGG - Intergenic
984639373 4:182144858-182144880 CCCCGGGAGGCGGCGGACGCGGG + Intronic
984966373 4:185143546-185143568 CGGCGCGAGCTGCAGGGCGCGGG + Intronic
985111976 4:186555468-186555490 CGCGGCGTGGAGGAGCGCGCGGG - Exonic
985466700 4:190203576-190203598 CGCCGCCGGGCGGGGAGCGCGGG - Intergenic
985466755 4:190203835-190203857 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
985466762 4:190203864-190203886 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
985466769 4:190203893-190203915 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
985466776 4:190203922-190203944 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
985466783 4:190203951-190203973 CGCAGAGAGGCGCGGGGCGCCGG - Intergenic
985572437 5:655624-655646 CGCGGGGTGGCGGAGGGCGCGGG + Intronic
986320996 5:6632873-6632895 CGCGGCGAGGCGGTAGGAGCCGG - Exonic
987373989 5:17217747-17217769 CGCCGAGAGGCCGGGGTCGCTGG - Exonic
989074188 5:37545607-37545629 AGCCGGGAGGCGGAGGTTGCAGG - Intronic
992312158 5:75511689-75511711 CGCCGGGAGGGGGACGGGGCGGG - Intronic
992769702 5:80035499-80035521 CCCCGCGAGGCCGGGGGCGACGG - Exonic
993898772 5:93570756-93570778 CCCCGCGCGGCGGAGGGGCCCGG - Intergenic
995224656 5:109689643-109689665 CGCGGGGAGGCGCAGGGGGCGGG - Exonic
997302011 5:132813427-132813449 CGTCTCGGGGCGAAGGGCGCCGG - Intergenic
997305014 5:132830477-132830499 GGCGGCGAGGCGGTGGTCGCGGG - Intronic
998130403 5:139648786-139648808 CGCCGCGAGGCCGAGGGGGAGGG - Exonic
1001576890 5:172770614-172770636 CGCCTCGCGGCAGAGCGCGCCGG + Exonic
1001611514 5:173006531-173006553 ACCCGGGAGGCGGAGGTCGCAGG + Intronic
1002190166 5:177473673-177473695 CGGCGGGGGGCGGGGGGCGCTGG + Intronic
1002927180 6:1611328-1611350 GGCGGCGGGGCGGAGGGCGCGGG - Exonic
1003139084 6:3456522-3456544 CGGCGCGAGGCGGCGGGCGGCGG - Exonic
1003942677 6:11044381-11044403 CGGCGCGAGCCCGAGGGGGCGGG - Intergenic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1006512128 6:34527176-34527198 CGCCGCGGGGCGGGGGGCGGGGG + Intronic
1006665085 6:35688264-35688286 CGCCGGGACGCCGCGGGCGCGGG - Intronic
1007573810 6:42911799-42911821 CCCCGGGAGGGGGAGGGAGCGGG - Intergenic
1013459014 6:110358003-110358025 CGCCGGGGGGCGGCGGGAGCGGG - Exonic
1014272304 6:119348946-119348968 CTCCGTCAGGCGGAGGGCGGCGG + Exonic
1015965462 6:138692700-138692722 CGGCCCGAGGCGGCGGGGGCCGG - Intergenic
1016597009 6:145814552-145814574 CGCCGCAGCGCGGACGGCGCCGG + Intronic
1016982287 6:149864266-149864288 GGCGGAGAGGCGCAGGGCGCTGG - Intergenic
1018020948 6:159761961-159761983 CGCGGGGAGGTGGAGGGCGAGGG + Exonic
1018688166 6:166319398-166319420 TGCAGGGAGGAGGAGGGCGCTGG + Intergenic
1018774328 6:166999290-166999312 CGCCCCGACGCGCAGCGCGCTGG - Exonic
1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG + Intronic
1025829808 7:65038759-65038781 GGCCGCGGGGCGGAGGTGGCGGG + Intergenic
1025917063 7:65873759-65873781 GGCCGCGGGGCGGAGGTGGCGGG + Intronic
1027218918 7:76201927-76201949 CGCGGGGAGGCAGAGGGTGCGGG + Exonic
1032159852 7:129502240-129502262 CGGGGCGAGGGGGCGGGCGCGGG - Intergenic
1032159861 7:129502259-129502281 CGGGGCGAGGGGGCGGGCGCGGG - Intergenic
1032159870 7:129502278-129502300 CGGGGCGAGGGGGCGGGCGCGGG - Intergenic
1034335913 7:150323431-150323453 GGCCGCCAGGCGGCGGGCGGCGG + Exonic
1034617934 7:152435530-152435552 CGCCGGGGCGCGGAGGCCGCGGG + Intronic
1035475999 7:159144689-159144711 CGCCGTGGGGCGGGGGTCGCGGG + Intronic
1035512981 8:206466-206488 CGCCGCCGGGCGGGGAGCGCGGG + Intergenic
1035752004 8:2002723-2002745 CGCGGCGAGGCGCAGGCGGCGGG + Exonic
1036723702 8:11200996-11201018 GGCCGCGCGGCCGAGGGCGTCGG + Exonic
1037305224 8:17497261-17497283 CGCCGAGAGGCCGCGGGCGAGGG + Intronic
1037769183 8:21789029-21789051 CGGCGCGGGGCGCGGGGCGCGGG + Intronic
1038447574 8:27614674-27614696 CGTCGCCAGGAGGAGCGCGCGGG - Exonic
1042137404 8:65645128-65645150 CGCCGCCTGGCGGCCGGCGCGGG - Intronic
1042236009 8:66613518-66613540 CGCCGAGAGGCGCACCGCGCGGG + Intronic
1042307183 8:67343871-67343893 CGCCGGGAGGCTGGGGGCGGAGG + Intergenic
1042722518 8:71841695-71841717 CCCCGCGCGGAGGAGCGCGCAGG - Exonic
1044663368 8:94612819-94612841 CGCCGGCAGGCGGAGGCCGGAGG - Intergenic
1048009390 8:130443721-130443743 CGCTCGGCGGCGGAGGGCGCGGG + Intergenic
1049897107 9:118444-118466 GGGTGCGAGGAGGAGGGCGCTGG - Intergenic
1050175247 9:2863525-2863547 GGGCGGGAGGCGGGGGGCGCTGG + Intergenic
1050512986 9:6413774-6413796 CCCCGCGAGGCGCGGGGTGCGGG + Intronic
1052804940 9:33004707-33004729 AGCCGCGAGGTGGAGGTTGCAGG - Intronic
1054324141 9:63704695-63704717 CGCAGAGAGGCGCACGGCGCCGG + Intergenic
1054496323 9:65825659-65825681 GGCGGCGAGGCGGACGGCGGCGG + Intergenic
1055611792 9:78031621-78031643 CGCCGCCAGGCGCACGGCGTAGG - Intergenic
1056659605 9:88534634-88534656 CGCAGTGAGGGGGAGGGCGCGGG + Intergenic
1057600042 9:96450108-96450130 CGCAGCGGGGCGGACGGCGGCGG + Intergenic
1059936537 9:119317012-119317034 ACCCGGGAGGCGGAGGTCGCCGG + Intronic
1059942203 9:119369362-119369384 CGCGGGGAGGAGGAGAGCGCAGG - Exonic
1061050438 9:128191739-128191761 CTTCGCGATGCGGAGGACGCGGG - Intronic
1061052401 9:128204217-128204239 CGCGGCGAGGGGGGAGGCGCGGG + Intronic
1062003909 9:134229915-134229937 TGCCGCGAGCCAGAGGGCACTGG - Intergenic
1062367309 9:136216985-136217007 CGGAGCGAGGCCGTGGGCGCAGG - Intronic
1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG + Intronic
1186423260 X:9443493-9443515 CGGCGCGGGGCGGAGGGAGGGGG + Intergenic
1186466076 X:9785855-9785877 CGCCCCGAGACGGAGGAGGCCGG + Intronic
1187172922 X:16869756-16869778 CGCCCCGGGGCCGAGGGCGCCGG + Exonic
1196424980 X:115561120-115561142 GGCCGAGGGGCGGAGGGGGCTGG + Intergenic
1196820204 X:119695049-119695071 CTCCGCGAGACAGAAGGCGCAGG + Intergenic
1198270516 X:135052049-135052071 CGCCGCGGGCCGGAGGGGCCCGG + Exonic