ID: 1025083850

View in Genome Browser
Species Human (GRCh38)
Location 7:56006814-56006836
Sequence CAGCTGTTAAAGAGGACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025083843_1025083850 29 Left 1025083843 7:56006762-56006784 CCAGCTCTGAATGTAATCTCACA No data
Right 1025083850 7:56006814-56006836 CAGCTGTTAAAGAGGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025083850 Original CRISPR CAGCTGTTAAAGAGGACAGC AGG Intergenic
No off target data available for this crispr