ID: 1025089808

View in Genome Browser
Species Human (GRCh38)
Location 7:56052331-56052353
Sequence CGGGCTTTTCCCAGATTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025089808_1025089814 23 Left 1025089808 7:56052331-56052353 CCCTAAAATCTGGGAAAAGCCCG 0: 1
1: 0
2: 1
3: 5
4: 91
Right 1025089814 7:56052377-56052399 TCGTTGAAAAAGTCATAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025089808 Original CRISPR CGGGCTTTTCCCAGATTTTA GGG (reversed) Intronic
904832297 1:33312796-33312818 GGGGCTTTTACCTGAATTTAGGG + Exonic
905961711 1:42048410-42048432 TCAGCTTTTCCCTGATTTTAGGG + Intergenic
910850292 1:91643413-91643435 CAGGCCTTTCCCAAATTTGATGG + Intergenic
912670990 1:111623791-111623813 AGGGCTTTGCCCAGAATTTCTGG + Intronic
921595062 1:217045679-217045701 CGGGCTTTTCCTAGATACGACGG + Intronic
922923406 1:229327969-229327991 CGGGGGTTCCCCAGAATTTAGGG - Intronic
923305662 1:232686038-232686060 CTGTCTTTTCCCAGACTCTATGG + Intergenic
923489986 1:234475861-234475883 CAAACTTTTCCCAGATTTTGTGG - Intronic
1070918043 10:80167383-80167405 AGGGCTGTTCCCAGAGTCTAGGG - Intronic
1073630678 10:105145537-105145559 CTGGTTTTTCCCAGATGTTTTGG - Intronic
1078742719 11:14082156-14082178 CTGTCATTTCCCAGAATTTAGGG + Intronic
1079047935 11:17125152-17125174 AGGCATTTTCACAGATTTTAAGG + Intronic
1081887758 11:46513801-46513823 CTGGCTTTTCCTATTTTTTAAGG + Intronic
1082791655 11:57349943-57349965 CAGCCCTTTCCCAGATTTCAGGG + Intronic
1084618041 11:70249593-70249615 CAGGCTTCTCCCAGCTTCTAGGG + Intergenic
1085722043 11:78921168-78921190 CTGGCTCTTCCCAGCTTTTCTGG - Intronic
1088831491 11:113540543-113540565 TGGGCTTTTCCCAGCCTCTAGGG - Intergenic
1090140208 11:124250094-124250116 CTTGCTTTTCTCTGATTTTAGGG + Exonic
1094788043 12:33874176-33874198 CTACCTTTTCCCAGATTTGAAGG - Intergenic
1097358455 12:58629823-58629845 CTGCCTTTTCCCAGTTTTTGTGG - Intronic
1102795916 12:115688707-115688729 GGGGCCTTTTCCAGATGTTAGGG - Intergenic
1104105778 12:125657651-125657673 CTGGATTTTCCAGGATTTTATGG + Exonic
1104190506 12:126478167-126478189 CGTTCTTTTAACAGATTTTATGG + Intergenic
1112765133 13:102733672-102733694 CGGCCTTTTCCCACTTCTTATGG + Exonic
1115492756 14:33973964-33973986 TGGGCATCTCCCAGTTTTTAAGG - Intronic
1117481253 14:56147637-56147659 GGGTATTTTCCCAGATTTCATGG - Intronic
1120192450 14:81451590-81451612 TGGTCTTTACACAGATTTTAAGG - Intergenic
1127777863 15:62282248-62282270 TGGGCTCTTCCTAGATTATATGG + Intergenic
1128121851 15:65155041-65155063 CTGCCTTTTCCCAGATTAGATGG + Exonic
1129619034 15:77126876-77126898 AGGGCTTTTCCTGGATTTGAAGG - Intronic
1132489753 16:221023-221045 TTGGCTTTTGCCAGTTTTTAAGG + Intronic
1139077685 16:63473324-63473346 CCTGCTTGCCCCAGATTTTAGGG - Intergenic
1139254278 16:65526478-65526500 TGGGCTTTGCCCAGTATTTAGGG - Intergenic
1149641517 17:58205944-58205966 CGGGAATTTCCCAGCTTTTCTGG + Exonic
1149661539 17:58336703-58336725 CTGCCTTTTCCCAGATGTTGTGG - Intergenic
1157457182 18:47842959-47842981 TGGGCTTTTCTCATATTTGAAGG - Intronic
1164804211 19:31103778-31103800 CAGGCTTGTCCTGGATTTTAGGG - Intergenic
1168596442 19:57681715-57681737 GGGGCTTTTCCCAGATTTCTGGG - Intergenic
925190803 2:1881924-1881946 CGGGCTTTGCCCTGATTTTGAGG + Intronic
926706402 2:15840846-15840868 CGGACATTTCCAAGATTTTTTGG + Intergenic
927210882 2:20638345-20638367 AGGGCTTTTCTCAGATTCCAGGG + Intronic
933068845 2:77833335-77833357 CAAACTTTTCCCAGTTTTTAAGG - Intergenic
935400164 2:102652023-102652045 CTGGCTTTTTCCAGACTCTATGG + Intronic
940581912 2:155591183-155591205 CTGGCTCTTCTAAGATTTTAGGG - Intergenic
944203890 2:197136846-197136868 CTGGCTAGTCCCAGATTTTTAGG - Intronic
946979999 2:225200655-225200677 AGGGCTTTTAATAGATTTTATGG + Intergenic
947058893 2:226139307-226139329 CGTGCTCTTCCCAGAGTTTGAGG + Intergenic
1173734605 20:45350379-45350401 CGGGGTTTCCACAGATTTAAAGG + Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
950664484 3:14486974-14486996 CTGTTTTTTCCCTGATTTTATGG + Exonic
950935690 3:16836635-16836657 TGGCCTTTTCCCTGATTTCAGGG - Intronic
950952281 3:17013115-17013137 AGGGCTTTTCCCTGTTTTTGAGG + Intronic
951863450 3:27279870-27279892 CGGCCTACTTCCAGATTTTAAGG - Intronic
952234837 3:31468501-31468523 CAGGCTTTTCATAGCTTTTAAGG - Intergenic
952901099 3:38112196-38112218 CGGTTCTTTCCCAGATTTTATGG + Exonic
955837767 3:63076404-63076426 TGGGATTTTCCCAGATATTGTGG - Intergenic
956794027 3:72702045-72702067 CTGGCTTTTCCCAGATCTCCTGG + Intergenic
959627247 3:108466487-108466509 CTGGTTTTTCCCAGATGTCAAGG - Intronic
963902187 3:150743342-150743364 GGGGCTTTGCCCATATTTTTTGG + Intronic
964380785 3:156097175-156097197 TGGGATTTTACCAGATTTTCGGG - Intronic
981159337 4:141478617-141478639 TTGGTTTTTTCCAGATTTTAGGG + Intergenic
983673213 4:170262003-170262025 TGGGATGTTCCCAGTTTTTATGG + Intergenic
988135034 5:27159323-27159345 AGGGCTTTTCACAGATTAAAAGG + Intergenic
989569248 5:42929850-42929872 CTGGTGTTCCCCAGATTTTAAGG + Intergenic
991476888 5:67031268-67031290 TGGGCATTTCCCAGAGTTGATGG + Intronic
996144264 5:119954275-119954297 CAGGCTTTTGCCACATTGTAAGG + Intergenic
998270417 5:140701318-140701340 CCGGCTTTTCTCAGACTATATGG - Intronic
999065098 5:148676955-148676977 TGAGCTTTGCGCAGATTTTATGG - Intronic
1005935150 6:30515558-30515580 AAAGCCTTTCCCAGATTTTAGGG - Intergenic
1009000922 6:57713583-57713605 CTGTCTTTTTCCTGATTTTAGGG - Intergenic
1014018557 6:116562875-116562897 CTGGCTTTTTCCAGTTTCTAGGG - Intergenic
1018905454 6:168073083-168073105 TGGACTTTTCCCAGTTTTCAGGG - Intronic
1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG + Exonic
1025089808 7:56052331-56052353 CGGGCTTTTCCCAGATTTTAGGG - Intronic
1025901960 7:65751622-65751644 CGGGCTTTTCCCCGATCTTAGGG - Intergenic
1025901972 7:65751704-65751726 AGGACTTTTCCCAGATCTCAGGG - Intergenic
1029285987 7:99466365-99466387 CGGCCTCTTCCCACCTTTTAAGG - Intergenic
1032702234 7:134392435-134392457 CAGGCCTTTCCCAGATATTCCGG - Intergenic
1037049915 8:14360186-14360208 TTGTCTTTTTCCAGATTTTAAGG - Intronic
1040379287 8:46856676-46856698 AGGACTTTTGCCATATTTTAAGG + Intergenic
1044402045 8:91783907-91783929 AGGGCTTTTCCCAGATCTGCAGG + Intergenic
1045323462 8:101099333-101099355 CGGGATTATCCTAGATTTTCTGG + Intergenic
1048176120 8:132154253-132154275 GGGGCTTTTACCAGTTTGTATGG - Intronic
1052962621 9:34313308-34313330 TGGGCTTTGCCCAGATATTTGGG - Intronic
1056474757 9:86943231-86943253 CGCTCTTTTCCCAGCTTTTATGG - Intergenic
1059997844 9:119930521-119930543 AGAGCTTTTCCAAGATTTCAAGG + Intergenic
1060764418 9:126283130-126283152 CAGGCCTTTTCCAGCTTTTAGGG - Intergenic
1061598250 9:131646712-131646734 CTGGCTTTACCCACATTTTCAGG - Intronic
1203565095 Un_KI270744v1:82767-82789 AGTGCTTCTCCCAGACTTTAGGG + Intergenic
1186594049 X:10961304-10961326 CTTGCTTTTCCCAGCTTTAAAGG - Intergenic
1194769264 X:97880986-97881008 TGGGTTTTTGCCAAATTTTAAGG + Intergenic
1198518198 X:137428781-137428803 CGGGCTTTTCCTATGTTTTTCGG + Intergenic
1200144225 X:153918180-153918202 TGGGCTTATCCCAGAATTTTTGG - Intronic
1200359758 X:155592400-155592422 CAGGCTTTTCCCAAGTTTTGGGG - Intronic
1200856903 Y:7948805-7948827 AGGCCTTTTGCCATATTTTAGGG - Intergenic
1202261404 Y:22974075-22974097 AGGCCTTTTGCCATATTTTAGGG + Intronic
1202414392 Y:24607816-24607838 AGGCCTTTTGCCATATTTTAGGG + Intronic
1202456393 Y:25062270-25062292 AGGCCTTTTGCCATATTTTAGGG - Intronic