ID: 1025093718

View in Genome Browser
Species Human (GRCh38)
Location 7:56082216-56082238
Sequence AATCTCAGGGGCCAGGTAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 132}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025093713_1025093718 -1 Left 1025093713 7:56082194-56082216 CCTCATTCATGGAGCACTCGATA 0: 1
1: 0
2: 2
3: 11
4: 68
Right 1025093718 7:56082216-56082238 AATCTCAGGGGCCAGGTAACTGG 0: 1
1: 1
2: 0
3: 10
4: 132
1025093704_1025093718 26 Left 1025093704 7:56082167-56082189 CCACCTCTTTCCCGTAGCCCGGG 0: 1
1: 0
2: 2
3: 8
4: 113
Right 1025093718 7:56082216-56082238 AATCTCAGGGGCCAGGTAACTGG 0: 1
1: 1
2: 0
3: 10
4: 132
1025093706_1025093718 23 Left 1025093706 7:56082170-56082192 CCTCTTTCCCGTAGCCCGGGTGG 0: 1
1: 0
2: 1
3: 3
4: 78
Right 1025093718 7:56082216-56082238 AATCTCAGGGGCCAGGTAACTGG 0: 1
1: 1
2: 0
3: 10
4: 132
1025093712_1025093718 8 Left 1025093712 7:56082185-56082207 CCGGGTGGTCCTCATTCATGGAG 0: 1
1: 1
2: 2
3: 24
4: 124
Right 1025093718 7:56082216-56082238 AATCTCAGGGGCCAGGTAACTGG 0: 1
1: 1
2: 0
3: 10
4: 132
1025093711_1025093718 9 Left 1025093711 7:56082184-56082206 CCCGGGTGGTCCTCATTCATGGA 0: 1
1: 1
2: 2
3: 7
4: 97
Right 1025093718 7:56082216-56082238 AATCTCAGGGGCCAGGTAACTGG 0: 1
1: 1
2: 0
3: 10
4: 132
1025093709_1025093718 15 Left 1025093709 7:56082178-56082200 CCGTAGCCCGGGTGGTCCTCATT 0: 1
1: 2
2: 0
3: 7
4: 71
Right 1025093718 7:56082216-56082238 AATCTCAGGGGCCAGGTAACTGG 0: 1
1: 1
2: 0
3: 10
4: 132
1025093708_1025093718 16 Left 1025093708 7:56082177-56082199 CCCGTAGCCCGGGTGGTCCTCAT 0: 1
1: 1
2: 0
3: 7
4: 67
Right 1025093718 7:56082216-56082238 AATCTCAGGGGCCAGGTAACTGG 0: 1
1: 1
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025093718 Original CRISPR AATCTCAGGGGCCAGGTAAC TGG Exonic
901171880 1:7265028-7265050 AGCCTCAGGGGCCAGGGAGCCGG + Intronic
901456542 1:9366289-9366311 AAGCTCAGGCCCCAGGAAACTGG - Intronic
904907533 1:33909184-33909206 AACCTCAGAGGACAGGTACCAGG + Intronic
909348073 1:74615917-74615939 AATCTCAAAGGCAAGCTAACAGG + Intronic
910840619 1:91557476-91557498 AACCTCAGAGGCCAGGTGACAGG + Intergenic
924600532 1:245484849-245484871 ACTCTCAGGGGCCCAGTCACAGG - Intronic
1064409668 10:15093829-15093851 AATCTCAGAGGTCAGATGACAGG - Intergenic
1067752641 10:48982257-48982279 AAGCTCAGGCCCCAGGGAACAGG - Intronic
1069190328 10:65479473-65479495 AATCGCAGGGGCCAGAGACCTGG - Intergenic
1069757655 10:70782931-70782953 AAACTCAGGGGCCAAGTCAGTGG - Intronic
1073106358 10:101034596-101034618 AAGCTCAGGGGCCAGGGCAGGGG + Intronic
1076061231 10:127415866-127415888 AATGTCAGGGCCAAGGCAACTGG + Intronic
1076121879 10:127942984-127943006 AATCACGTGGGCCAGGAAACCGG + Intronic
1076476553 10:130757728-130757750 AATCACAGGGGCCCTGAAACTGG - Intergenic
1079563753 11:21854753-21854775 AATCTCAGGAGTCATGTAGCAGG - Intergenic
1082278822 11:50247723-50247745 GATCTCAGGGGCCAGGTAACTGG + Intergenic
1083320975 11:61846460-61846482 AACCTCAGGGCCCTGGAAACTGG - Intronic
1089748047 11:120630598-120630620 CCTCTCAGGAGCCAGGTAAGGGG + Intronic
1090157960 11:124461354-124461376 ATTCTCTTGGGCCAGGGAACTGG - Intergenic
1090398042 11:126432098-126432120 AGTCTCAGGGTCCAGGGAGCAGG + Intronic
1091636904 12:2203880-2203902 AATCTCAGGGCCCAGGTCCCCGG + Intronic
1091638945 12:2219786-2219808 AATTTCAGAGGCCAGGTATCAGG + Intronic
1101516836 12:105444112-105444134 AATCTCAGGAGCTGGGTAAGCGG + Intergenic
1101851275 12:108404264-108404286 CATCTCAGGGGGTAGGAAACAGG - Intergenic
1103923576 12:124411843-124411865 GATCTCAGGGGCCAGGTTCCGGG + Intronic
1107016844 13:35714479-35714501 AGTGTCAGGGGCTAGGTGACTGG + Intergenic
1107093297 13:36507780-36507802 AAGCTCAGTGTCCAGGTAAATGG - Intergenic
1107218110 13:37946413-37946435 AATTTGAGGGGCCAGGTACTGGG - Intergenic
1110609949 13:77476439-77476461 GATCTCAGGGGCTGGGTAAGTGG - Intergenic
1110626177 13:77658621-77658643 TATCACAGGGGCCAGGTCAGAGG - Intergenic
1114829638 14:26124975-26124997 AAGCACAGGGGCCAGCTAGCTGG - Intergenic
1115092706 14:29597663-29597685 GACCTCAGGAGCCAGGTAAGCGG + Exonic
1115427497 14:33277520-33277542 AATATAAGGGGCTAGGTAAAAGG + Intronic
1116463275 14:45202473-45202495 TATCTCACCGGCCAGGTACCTGG - Intergenic
1117008750 14:51448958-51448980 CATCTCAGGCACCAGGTAAATGG + Intergenic
1120914255 14:89696717-89696739 AATATTAGGGGCCAGGGAAAAGG - Intergenic
1121011508 14:90522819-90522841 GATCTCAGGGGACAGGTGATGGG - Intergenic
1125321905 15:38497974-38497996 ACCCTGAGGGGCCAGGTAGCAGG - Intronic
1130510376 15:84584030-84584052 AAGATCTGGGGCCAGGGAACAGG + Intergenic
1130584552 15:85171008-85171030 AAGATCTGGGGCCAGGGAACAGG - Intergenic
1135175059 16:20220800-20220822 ACTCTCAGGGACCAGGGACCTGG - Intergenic
1135687129 16:24506909-24506931 TATCTCAGGGGCCAGGTGGGAGG - Intergenic
1137265071 16:46862158-46862180 CACCTCAGGGGCCAGCAAACAGG + Intergenic
1137536389 16:49329948-49329970 AATCACAGGGGCCAGGGAGCAGG - Intergenic
1139176238 16:64691747-64691769 TATCTCAGGCCCCAAGTAACTGG + Intergenic
1139270904 16:65681696-65681718 GCTCTCAGGGGCCAGGAAACAGG + Intergenic
1139460806 16:67120978-67121000 AATCTCTGGGTATAGGTAACAGG - Intronic
1141647572 16:85375784-85375806 AGTCACAGGGGCCAGGGTACTGG - Intergenic
1142557842 17:791630-791652 AGTGTCAGGGGGCAGGTAATTGG - Exonic
1143120477 17:4603509-4603531 CATCTCAGGGTCCAGGGAAAGGG - Intronic
1144299032 17:13905945-13905967 AATCCCTGGGGCCTGGTAGCTGG - Intergenic
1151057352 17:71048964-71048986 AATAACAGGGCCCAGGGAACAGG + Intergenic
1157193845 18:45603853-45603875 AATTTCAGATGCCAGGTAACTGG + Intronic
1160105002 18:75965656-75965678 AATCTCAGGAGTCAGACAACTGG + Intergenic
1161512282 19:4678520-4678542 CTTCCCAGGGGCCAGGTAGCTGG - Intronic
1162017748 19:7854702-7854724 AAACCCAGGGGCCAGGGATCAGG + Intronic
1162300370 19:9841658-9841680 AATGTCAAGGGCCAGGGAAGTGG + Intronic
1164453134 19:28383892-28383914 AATTTCAGGGGCAGGGTACCAGG + Intergenic
1164738870 19:30562011-30562033 CAGCTTAGGGGCCAGGTTACTGG + Intronic
926695362 2:15766884-15766906 TCTCTCAGGGGCCAGGTTCCAGG - Intergenic
927201066 2:20578341-20578363 AGCCTCAGGGCCCAGGTAATAGG - Intronic
927722797 2:25397459-25397481 AATCTCAGGGCACAGGAAGCAGG + Intronic
927827102 2:26316634-26316656 TGTCTCGGGGGCCAGGGAACAGG + Intronic
928700445 2:33893644-33893666 AATTTGAGGGTCAAGGTAACTGG - Intergenic
929851863 2:45598773-45598795 AATCACATGGGACAGATAACAGG + Intronic
930832451 2:55759563-55759585 TATCCCAGGGCCCAGGTACCAGG + Intergenic
935261485 2:101359459-101359481 TATCTCAGGAGCCGGGTAAGTGG - Intronic
936047236 2:109197219-109197241 AATCTCAGGGACCAGGTCAGGGG + Intronic
937216401 2:120316243-120316265 AATGCCAGGGCCCAGGAAACCGG + Intergenic
938436055 2:131284180-131284202 CATCTGTGGGGCCAGGTAATGGG + Intronic
941654469 2:168128120-168128142 CCTCTCAGGGACCAGCTAACAGG + Intronic
941759954 2:169231205-169231227 AATCACAGGGGCCCGGAAAGTGG + Intronic
942690167 2:178576636-178576658 GATCTCAGGTGCAAAGTAACAGG - Exonic
943330342 2:186551373-186551395 AATTTCTGGGGGCAGGTAAGAGG - Intergenic
945418932 2:209610249-209610271 AATGACAGAGGCAAGGTAACAGG + Intronic
946059623 2:216930529-216930551 AATCTCAGTGGCCAGGGAGAGGG + Intergenic
1172900958 20:38334565-38334587 CATACCTGGGGCCAGGTAACAGG - Intronic
1173499419 20:43541668-43541690 AATATCAAGGGCCATGTATCAGG + Exonic
1174774809 20:53333889-53333911 CATCTCAAGGGCCAGATCACTGG + Intronic
1180568591 22:16696296-16696318 GATGTCAGGTGCCAGGTAGCAGG - Intergenic
1181032715 22:20156113-20156135 TATCTCAGAAGCCAGGAAACAGG + Intergenic
1183245068 22:36687030-36687052 CTTCTCAGGAGCCAGGTGACAGG + Intronic
1184819319 22:46897236-46897258 CAGCTCAAGGGCCTGGTAACTGG + Intronic
1185378640 22:50495746-50495768 AATCTCAGAGGTCAGGTAGAAGG - Intergenic
950903916 3:16520507-16520529 TGTGTCAGGGGCCAGGGAACCGG - Intergenic
950968868 3:17166766-17166788 AATGTCAGGGGCCATTAAACAGG - Exonic
952187565 3:30986710-30986732 ATTCTCAGCGGCCAAGGAACAGG + Intergenic
952826196 3:37527019-37527041 GAACTCAGGGGCCAGGTGGCCGG + Intronic
954128321 3:48545847-48545869 ATTCTGAGAGTCCAGGTAACTGG + Intronic
954323029 3:49844798-49844820 AATCTCAGGGGCAAGGCCCCAGG + Intronic
954368202 3:50157018-50157040 AATCTGAGGGGCTGGGTAGCGGG + Intronic
959658059 3:108832713-108832735 TTGCTGAGGGGCCAGGTAACAGG + Intronic
962841160 3:139233935-139233957 TCTCTCACGGGCCAGGTAAAAGG + Intronic
963357085 3:144222017-144222039 AGGCTCAGGGGCAAGGAAACAGG + Intergenic
965783185 3:172309687-172309709 AACCTCAGGGGCCCAGTAAATGG - Intronic
966428542 3:179807414-179807436 AATCTCAGGGGCCAGGAATTGGG + Intronic
969402170 4:6962827-6962849 AGGCACAGGGGTCAGGTAACGGG - Intronic
969734365 4:8977188-8977210 AATATCCGGGGCCGGGGAACGGG - Intergenic
969998079 4:11335385-11335407 AATCTGAGACCCCAGGTAACTGG + Intergenic
970252314 4:14128839-14128861 AATCTCTGGAGCCAGTGAACAGG - Intergenic
972831361 4:42817641-42817663 AGTCACAGGGCCCAAGTAACCGG + Intergenic
974331302 4:60482404-60482426 AAGATCAGGCGCCAGGTGACGGG + Intergenic
976270178 4:83222496-83222518 GTTGTCAGGGGCCAGGTAGCAGG - Intergenic
984646440 4:182225462-182225484 AAGATCAGGTGCCAGGTAATAGG - Intronic
986080012 5:4380941-4380963 CATCTCAGGGTGCAGGTATCTGG + Intergenic
988245098 5:28670107-28670129 AACATCAGGGGCCAGGAAGCTGG + Intergenic
990330199 5:54718448-54718470 GATCTCAGGTTCCAGGAAACTGG + Intergenic
991740416 5:69666823-69666845 AAGCACAGGGGCCAGGTGAAAGG + Intergenic
991791991 5:70246564-70246586 AAGCACAGGGGCCAGGTGAAAGG + Intergenic
993357299 5:86930246-86930268 AATGTGAGAAGCCAGGTAACAGG + Intergenic
1001104326 5:168840168-168840190 AATCACTGGTGCCAGGTAAATGG - Intronic
1002881126 6:1253730-1253752 GATCTCAAGGGCCAGGAAAAGGG - Intergenic
1006829056 6:36957975-36957997 AATCTCAGGGGCCAGTGATTTGG + Intronic
1007292453 6:40797923-40797945 AAACTCAGGAGCCAGGTGCCTGG + Intergenic
1007312380 6:40956734-40956756 GACCTCAGGGACCAGGTCACAGG + Intergenic
1009893583 6:69719881-69719903 AATCTCATGGCCCATCTAACAGG - Intronic
1012015453 6:93843839-93843861 AATCTCAGGAGCCAGGGCACAGG + Intergenic
1023059157 7:36312464-36312486 CATCTCTGGGGCCTGGCAACTGG - Intergenic
1025093718 7:56082216-56082238 AATCTCAGGGGCCAGGTAACTGG + Exonic
1028070950 7:86449888-86449910 AATCTCAGAAGCCATGTAAATGG - Intergenic
1033773257 7:144577938-144577960 AATAGCAGGTGGCAGGTAACTGG + Intronic
1034082432 7:148291878-148291900 AATCTTAAGGGCCAGGAAAAGGG + Intronic
1034467225 7:151237295-151237317 AATCTCAGAGCCCAGGCAGCTGG + Intronic
1035529784 8:342318-342340 ATTATCAGGGGTCAGGTCACGGG - Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037113070 8:15189624-15189646 AATCTCAGAGCCCAGCTCACTGG + Intronic
1040664954 8:49620852-49620874 AATCTCAGGAGTCAGGTGAGTGG + Intergenic
1045273455 8:100681063-100681085 CACCTCAGGGGCCAGGGAAGTGG - Intergenic
1047891574 8:129317468-129317490 TATATCAGGGGCCAGGAATCTGG - Intergenic
1048516132 8:135113446-135113468 AATTTCAGGGGCCAGGCCAAGGG + Intergenic
1049623039 8:143607156-143607178 AGCCTCAGGGGCCATGTAAGCGG + Intronic
1051509110 9:17857886-17857908 AAGCTCAGAGGACAGGTAAGTGG - Intergenic
1051545478 9:18269935-18269957 AATCTCAGGGACCAGGTCTTTGG + Intergenic
1060899352 9:127244096-127244118 AATCTCAAGGGGCAGGTCTCAGG - Intronic
1061971665 9:134048599-134048621 AGGCTCAGGGGCCATGTCACTGG + Intronic
1187607281 X:20899257-20899279 AATCACAGGTGCCAGGGAATAGG + Intergenic
1194029140 X:88789805-88789827 AATCTCTTGGGCCAAGGAACTGG + Intergenic
1194647441 X:96474582-96474604 AATGTCACGGGCCAGCAAACAGG - Intergenic
1195129158 X:101837708-101837730 AATCACAGGGGCCAAGGACCAGG - Intronic
1195177082 X:102322122-102322144 AATCACAGGGGCCAAGGACCAGG + Intronic
1195181782 X:102364971-102364993 AATCACAGGGGCCAAGGACCAGG - Intronic
1195203016 X:102567530-102567552 AAACTGAGGGGTTAGGTAACAGG - Intergenic
1199505371 X:148555157-148555179 AGTGTCAGGGGCCAGGAGACTGG - Intronic
1200756236 Y:6992507-6992529 ACTCTCAGGAGCCAGGTATTAGG + Intronic