ID: 1025093910

View in Genome Browser
Species Human (GRCh38)
Location 7:56083377-56083399
Sequence CAAACTCAACATCGTGCACC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025093910_1025093918 29 Left 1025093910 7:56083377-56083399 CCCGGTGCACGATGTTGAGTTTG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1025093918 7:56083429-56083451 TCGCATGATCTTTCTAGGGTGGG 0: 1
1: 0
2: 1
3: 4
4: 44
1025093910_1025093919 30 Left 1025093910 7:56083377-56083399 CCCGGTGCACGATGTTGAGTTTG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1025093919 7:56083430-56083452 CGCATGATCTTTCTAGGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 43
1025093910_1025093917 28 Left 1025093910 7:56083377-56083399 CCCGGTGCACGATGTTGAGTTTG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1025093917 7:56083428-56083450 CTCGCATGATCTTTCTAGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 40
1025093910_1025093915 24 Left 1025093910 7:56083377-56083399 CCCGGTGCACGATGTTGAGTTTG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1025093915 7:56083424-56083446 AGAGCTCGCATGATCTTTCTAGG 0: 1
1: 0
2: 1
3: 8
4: 111
1025093910_1025093916 25 Left 1025093910 7:56083377-56083399 CCCGGTGCACGATGTTGAGTTTG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1025093916 7:56083425-56083447 GAGCTCGCATGATCTTTCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025093910 Original CRISPR CAAACTCAACATCGTGCACC GGG (reversed) Exonic
900175857 1:1291077-1291099 CAAAATCAACATCGTCTACCAGG + Exonic
902859917 1:19237819-19237841 CCAGCTCATCATTGTGCACCAGG - Intronic
911662437 1:100516984-100517006 TAAAGTTAACATCGTGCACCAGG - Intronic
921635935 1:217493254-217493276 CAAACTCAAAATCTTGTACAAGG + Intronic
1063724830 10:8625281-8625303 CCAACTCAATATCCTGCAACTGG - Intergenic
1064354699 10:14606032-14606054 GAAACTGAGCATCTTGCACCTGG - Intronic
1064851555 10:19714345-19714367 CAAACTCCGCATCGTTCAGCTGG + Intronic
1084769955 11:71336181-71336203 CAATTTCACCACCGTGCACCTGG - Intergenic
1086538001 11:87872390-87872412 CACCATCAACATCCTGCACCTGG + Intergenic
1090920252 11:131200532-131200554 CAGACTCATCAGCATGCACCGGG - Intergenic
1092192379 12:6530298-6530320 CACCTTCAACATCCTGCACCAGG + Intronic
1092834875 12:12477882-12477904 CAAACTCAAGCTGCTGCACCTGG - Exonic
1099646484 12:85363892-85363914 CAAAATCAACATCATGTTCCTGG - Intergenic
1102238730 12:111310483-111310505 GAAACACAACATCGGGCAGCGGG + Exonic
1104942868 12:132403116-132403138 CAGACTCCACACCGTGCACCCGG - Intergenic
1105634557 13:22204567-22204589 CAAAGTCATCATCTTCCACCTGG - Intergenic
1110878717 13:80543019-80543041 CATACTCAACATTGTGCAAGTGG + Intergenic
1125177696 15:36844060-36844082 CAAAGTCAACTTAATGCACCCGG + Intergenic
1131275759 15:90979250-90979272 CAATCTCAGCATCGTGGAGCTGG + Exonic
1133398315 16:5465945-5465967 CAGACTCAACAAGGTGCCCCTGG - Intergenic
1138128198 16:54456198-54456220 CAAACCCAACAGCCAGCACCTGG - Intergenic
1138911119 16:61400093-61400115 CAAACTCAAGATCTTGCTCAAGG - Intergenic
1139348683 16:66321760-66321782 CAAATTCTACATCGAGCACTTGG + Intergenic
1140057397 16:71537265-71537287 CAACCTGCATATCGTGCACCTGG + Exonic
1140506900 16:75479228-75479250 CAACCTACGCATCGTGCACCTGG - Exonic
1140514071 16:75529718-75529740 CAACCTGCGCATCGTGCACCTGG - Exonic
1140894512 16:79313418-79313440 GGAACTCAACATCATGGACCTGG - Intergenic
1140958274 16:79888059-79888081 CAAACCCAACATTGACCACCAGG + Intergenic
1144943920 17:18960204-18960226 CAGCCTCATCATAGTGCACCTGG + Intronic
1144945743 17:18968699-18968721 CAAACTCATCAAGGTGCCCCTGG + Intronic
1146617858 17:34370842-34370864 CAGACACACCATCCTGCACCTGG + Intergenic
1156760560 18:40583794-40583816 CAAACTCCACATCGTTCCGCTGG + Intergenic
1157504685 18:48218096-48218118 CAAAGTCAACACCGAACACCAGG + Intronic
1157691110 18:49682664-49682686 CAAACTTAACAACGTGGACCAGG + Intergenic
1160939891 19:1615324-1615346 CAAACTGCTCATCCTGCACCAGG - Exonic
1164448246 19:28336118-28336140 CATAATCAACATCGTGATCCTGG - Intergenic
925256049 2:2489655-2489677 GAAAGTTAACATCGTGCTCCAGG + Intergenic
927786970 2:25981176-25981198 CAAGCTCAACCTCGTGGACCTGG - Exonic
936857530 2:116978304-116978326 CAGACTCAAAATCTTGCAACTGG - Intergenic
939067509 2:137501871-137501893 GAAGCTCAACATCGTTCACTGGG - Intronic
940647808 2:156409791-156409813 CAAAGTTAACATCCTGGACCAGG + Intergenic
1177644786 21:23887354-23887376 CAAACTCCACATCGTTCCGCTGG - Intergenic
949101992 3:156759-156781 CAAGCACAACATCGTTGACCAGG - Intergenic
951753227 3:26060384-26060406 CAAGCTCAACACCGTGGAGCTGG + Intergenic
952687821 3:36170343-36170365 GAAACTCACCACCCTGCACCAGG + Intergenic
956238667 3:67104656-67104678 CAAACTCATTATCCTGCTCCTGG - Intergenic
958694299 3:97508432-97508454 GAAACTCAACAACCTGCTCCTGG - Intronic
965357164 3:167690342-167690364 CAAACTCAACATAAAGCACAGGG - Intronic
968811911 4:2803930-2803952 CAAACGCCACACCCTGCACCCGG - Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
977190559 4:93994740-93994762 CAAACTCAATATTGTTCACAGGG - Intergenic
982504410 4:156198812-156198834 CAAACTCCACCTCGTGCCACCGG - Intergenic
987830453 5:23088469-23088491 CAATCTCTACATTGTGAACCTGG - Intergenic
991341196 5:65611683-65611705 CAAACTCAATGGCATGCACCTGG + Exonic
995302462 5:110600033-110600055 AAAACTCAACAACCTGCTCCTGG + Intronic
1009729883 6:67587790-67587812 CAAACTCATCATCAAGCACAAGG + Intergenic
1010835420 6:80581855-80581877 CAAACTCTACTTCTTGCTCCAGG + Intergenic
1024871499 7:53967250-53967272 AAATCTCAACATTGTGCATCTGG + Intergenic
1025093910 7:56083377-56083399 CAAACTCAACATCGTGCACCGGG - Exonic
1045951636 8:107858099-107858121 CAAACTCAACCTTGTGTATCTGG - Intergenic
1050388383 9:5112648-5112670 CAAACTCCTTATCCTGCACCAGG + Intronic
1060271225 9:122143484-122143506 CAAACTCAACCTCTTGCAAGAGG + Intergenic
1060787973 9:126465424-126465446 CAAACTCACCAGTGAGCACCAGG + Intronic
1061181465 9:129027475-129027497 CAATCTCAGCATCGTGGGCCTGG + Intronic
1186721072 X:12304779-12304801 AAAATTCAAAATCATGCACCAGG - Intronic
1189959080 X:46307646-46307668 CAAACTCCACATCGTTCTGCAGG + Intergenic
1197778402 X:130136131-130136153 CCAACTCAACATTGGGCTCCAGG + Exonic
1200234371 X:154461095-154461117 CAAACTCATCCTGGTACACCTGG - Exonic