ID: 1025105076

View in Genome Browser
Species Human (GRCh38)
Location 7:56163881-56163903
Sequence TTCCCAAGGCAGCAGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025105070_1025105076 25 Left 1025105070 7:56163833-56163855 CCATGCTGGAGAAGTCAGTGCAG No data
Right 1025105076 7:56163881-56163903 TTCCCAAGGCAGCAGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025105076 Original CRISPR TTCCCAAGGCAGCAGGGGAA AGG Intergenic
No off target data available for this crispr