ID: 1025106135

View in Genome Browser
Species Human (GRCh38)
Location 7:56173808-56173830
Sequence TGCCACTGGGTGATGGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025106128_1025106135 15 Left 1025106128 7:56173770-56173792 CCATATGATGAGCTTAGCAAAAA No data
Right 1025106135 7:56173808-56173830 TGCCACTGGGTGATGGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025106135 Original CRISPR TGCCACTGGGTGATGGGTAT GGG Intergenic
No off target data available for this crispr