ID: 1025110590

View in Genome Browser
Species Human (GRCh38)
Location 7:56212932-56212954
Sequence CCATTTATGCATAGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025110590_1025110596 2 Left 1025110590 7:56212932-56212954 CCAGTTTCCCTATGCATAAATGG No data
Right 1025110596 7:56212957-56212979 AGAATACTACCTTTTTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025110590 Original CRISPR CCATTTATGCATAGGGAAAC TGG (reversed) Intergenic
No off target data available for this crispr