ID: 1025115076

View in Genome Browser
Species Human (GRCh38)
Location 7:56250750-56250772
Sequence TGGAATTATACCTCTTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025115068_1025115076 3 Left 1025115068 7:56250724-56250746 CCCAAAAGCCTAACAGACTCTCC No data
Right 1025115076 7:56250750-56250772 TGGAATTATACCTCTTGGATGGG No data
1025115071_1025115076 -5 Left 1025115071 7:56250732-56250754 CCTAACAGACTCTCCACCTGGAA No data
Right 1025115076 7:56250750-56250772 TGGAATTATACCTCTTGGATGGG No data
1025115069_1025115076 2 Left 1025115069 7:56250725-56250747 CCAAAAGCCTAACAGACTCTCCA No data
Right 1025115076 7:56250750-56250772 TGGAATTATACCTCTTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025115076 Original CRISPR TGGAATTATACCTCTTGGAT GGG Intergenic
No off target data available for this crispr