ID: 1025115511

View in Genome Browser
Species Human (GRCh38)
Location 7:56254763-56254785
Sequence ACTTATGAACAGAAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025115511_1025115518 24 Left 1025115511 7:56254763-56254785 CCGTCCTCCTTCTGTTCATAAGT No data
Right 1025115518 7:56254810-56254832 CATTTGCTCACCCTTCTTCCAGG No data
1025115511_1025115515 -6 Left 1025115511 7:56254763-56254785 CCGTCCTCCTTCTGTTCATAAGT No data
Right 1025115515 7:56254780-56254802 ATAAGTGGTGCTTGTGCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025115511 Original CRISPR ACTTATGAACAGAAGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr