ID: 1025126839

View in Genome Browser
Species Human (GRCh38)
Location 7:56351505-56351527
Sequence AACCATTGGCTGATGAGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025126839_1025126847 25 Left 1025126839 7:56351505-56351527 CCCTTACTCATCAGCCAATGGTT No data
Right 1025126847 7:56351553-56351575 GTCATGGATGATGAAGCTCTCGG No data
1025126839_1025126844 -3 Left 1025126839 7:56351505-56351527 CCCTTACTCATCAGCCAATGGTT No data
Right 1025126844 7:56351525-56351547 GTTCCAACTGGAGAGAAGGCAGG No data
1025126839_1025126843 -7 Left 1025126839 7:56351505-56351527 CCCTTACTCATCAGCCAATGGTT No data
Right 1025126843 7:56351521-56351543 AATGGTTCCAACTGGAGAGAAGG No data
1025126839_1025126848 26 Left 1025126839 7:56351505-56351527 CCCTTACTCATCAGCCAATGGTT No data
Right 1025126848 7:56351554-56351576 TCATGGATGATGAAGCTCTCGGG No data
1025126839_1025126846 9 Left 1025126839 7:56351505-56351527 CCCTTACTCATCAGCCAATGGTT No data
Right 1025126846 7:56351537-56351559 GAGAAGGCAGGTGCTCGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025126839 Original CRISPR AACCATTGGCTGATGAGTAA GGG (reversed) Intergenic
No off target data available for this crispr