ID: 1025130493

View in Genome Browser
Species Human (GRCh38)
Location 7:56372175-56372197
Sequence CAGCTCAAAACCGCCTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025130493_1025130504 28 Left 1025130493 7:56372175-56372197 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130504 7:56372226-56372248 TACTTGCTGGGAGGCAGGGCCGG No data
1025130493_1025130505 29 Left 1025130493 7:56372175-56372197 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130505 7:56372227-56372249 ACTTGCTGGGAGGCAGGGCCGGG No data
1025130493_1025130500 16 Left 1025130493 7:56372175-56372197 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130500 7:56372214-56372236 AAAGAGCTTGCTTACTTGCTGGG No data
1025130493_1025130501 19 Left 1025130493 7:56372175-56372197 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130501 7:56372217-56372239 GAGCTTGCTTACTTGCTGGGAGG No data
1025130493_1025130502 23 Left 1025130493 7:56372175-56372197 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130502 7:56372221-56372243 TTGCTTACTTGCTGGGAGGCAGG No data
1025130493_1025130503 24 Left 1025130493 7:56372175-56372197 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130503 7:56372222-56372244 TGCTTACTTGCTGGGAGGCAGGG No data
1025130493_1025130499 15 Left 1025130493 7:56372175-56372197 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130499 7:56372213-56372235 CAAAGAGCTTGCTTACTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025130493 Original CRISPR CAGCTCAAAACCGCCTTTGT AGG (reversed) Intergenic
No off target data available for this crispr