ID: 1025130812

View in Genome Browser
Species Human (GRCh38)
Location 7:56373469-56373491
Sequence CAGCTCAAAACCGCCTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025130812_1025130821 23 Left 1025130812 7:56373469-56373491 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130821 7:56373515-56373537 TTGCTTACTTGCTGGGAGGCAGG No data
1025130812_1025130820 19 Left 1025130812 7:56373469-56373491 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130820 7:56373511-56373533 GAGCTTGCTTACTTGCTGGGAGG No data
1025130812_1025130819 16 Left 1025130812 7:56373469-56373491 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130819 7:56373508-56373530 AAAGAGCTTGCTTACTTGCTGGG No data
1025130812_1025130823 28 Left 1025130812 7:56373469-56373491 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130823 7:56373520-56373542 TACTTGCTGGGAGGCAGGGCCGG No data
1025130812_1025130824 29 Left 1025130812 7:56373469-56373491 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130824 7:56373521-56373543 ACTTGCTGGGAGGCAGGGCCGGG No data
1025130812_1025130818 15 Left 1025130812 7:56373469-56373491 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130818 7:56373507-56373529 CAAAGAGCTTGCTTACTTGCTGG No data
1025130812_1025130822 24 Left 1025130812 7:56373469-56373491 CCTACAAAGGCGGTTTTGAGCTG No data
Right 1025130822 7:56373516-56373538 TGCTTACTTGCTGGGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025130812 Original CRISPR CAGCTCAAAACCGCCTTTGT AGG (reversed) Intergenic
No off target data available for this crispr