ID: 1025132404

View in Genome Browser
Species Human (GRCh38)
Location 7:56383179-56383201
Sequence AGGCCAGGGAGTTGCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 13, 1: 31, 2: 9, 3: 48, 4: 425}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025132404_1025132419 28 Left 1025132404 7:56383179-56383201 CCCACCCAGCAACTCCCTGGCCT 0: 13
1: 31
2: 9
3: 48
4: 425
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025132404 Original CRISPR AGGCCAGGGAGTTGCTGGGT GGG (reversed) Intergenic
900016079 1:151059-151081 AGGCCAGGGAGTTGCTGGGCTGG - Intergenic
900046343 1:509653-509675 AGGCCAGGGAGTTGCTGGGCTGG - Intergenic
900068544 1:751365-751387 TGGCCAGGGAGTTGCTGGGCTGG - Intergenic
900158330 1:1212343-1212365 AGGACAGGGAGGTGCTGGTGGGG - Intronic
900187229 1:1338092-1338114 AGGCCAGGGGGCAGCCGGGTGGG + Exonic
900599101 1:3495567-3495589 GGGCCAGGCAGGCGCTGGGTAGG + Intronic
901053911 1:6440028-6440050 AGGGCAGGGCAGTGCTGGGTGGG + Intronic
901150375 1:7097278-7097300 AGGCCAGGGCTTTGATGGGGTGG + Intronic
901702559 1:11053481-11053503 AGGCCAGGCTGCAGCTGGGTGGG - Intergenic
902184140 1:14712402-14712424 AGGCCACTGAGATGCTGTGTGGG + Intronic
902480383 1:16708282-16708304 AGGGCAGGGCAGTGCTGGGTGGG - Intergenic
902755616 1:18547491-18547513 AGGCCTGTGAGCTGCTGGGGAGG - Intergenic
903071448 1:20728850-20728872 AGGCCAGGGACCTGCTGCATGGG + Intronic
903670172 1:25030880-25030902 TGGCCAGGGTGGGGCTGGGTGGG - Intergenic
903734899 1:25523844-25523866 AGGCCAGAGAGTAGCTTGGGTGG - Intergenic
903847535 1:26287401-26287423 AGGGCAGGTAGATGCTGGCTGGG + Intronic
903884814 1:26535024-26535046 GGGGCAGGGAGCTGGTGGGTAGG + Intronic
904030962 1:27533182-27533204 AGGCCAGGGCCTAGCTGGCTGGG + Intergenic
905562769 1:38940603-38940625 AGGTGAGGGAGTTGCTGGTTAGG + Intronic
905848723 1:41257430-41257452 TGTGCAGGGAGTTGCTGAGTTGG + Intergenic
906522338 1:46474913-46474935 AGGCCTGGGGGCTGCTGGGGTGG + Intergenic
906690596 1:47790412-47790434 AGGCCTGGGTGATGCTGGGGGGG - Intronic
906706457 1:47898479-47898501 AAGCCAGGGAGGCACTGGGTGGG + Intronic
906891563 1:49721468-49721490 AGGCCAGGGAATTGCTAGTATGG + Intronic
907273071 1:53302023-53302045 AGGCAAGGGAGATGCAGGCTTGG - Intronic
907910802 1:58824569-58824591 AGGCCAGGGGGTGGTAGGGTAGG + Intergenic
909457376 1:75865553-75865575 ATGCCAGGAAGTTGCTAGGTAGG + Intronic
911659841 1:100488996-100489018 AGGCCAGGGAGTTGGTGATGGGG + Intronic
912401714 1:109398357-109398379 AGCTCAGGGATTTCCTGGGTAGG - Intergenic
913030953 1:114902156-114902178 AGGCCATGGAAAGGCTGGGTTGG + Intronic
913393680 1:118342817-118342839 ATGCAAGGGAGCTACTGGGTAGG + Intergenic
914196744 1:145451711-145451733 GGGCCTGGGCGTTGCTGGGGTGG - Intergenic
914804346 1:150981805-150981827 AGTCAAGGGAGTTTCTGGGCTGG + Intergenic
914925069 1:151878109-151878131 AGAAAAGGGAGTTGCTGGGCAGG - Intronic
915631466 1:157156146-157156168 AGGACCGGGAGTTTCTGGGGAGG + Intergenic
915947284 1:160162705-160162727 AGGGAAGGGGGTTGGTGGGTAGG + Intronic
916479682 1:165203777-165203799 AGGCCAGGGAAGAGGTGGGTTGG - Exonic
918079290 1:181193312-181193334 AGGCCAGGGAGTGGATGGAAAGG - Intergenic
919265509 1:195259260-195259282 TTGTCAGGGAGTTGGTGGGTGGG - Intergenic
919685440 1:200479643-200479665 TGGCCATGGAGAGGCTGGGTTGG - Intergenic
919979492 1:202633499-202633521 AGGCCAGGTAGGGGCTGAGTGGG - Intronic
920051674 1:203168143-203168165 AGGCCAGAGAGGTGCAGAGTGGG + Intronic
920243840 1:204573315-204573337 AGGCCAGGTGGATGCTGGGATGG + Intergenic
920351532 1:205341197-205341219 AGGCCTGGGAGGTCCTGGGGTGG - Intronic
920387100 1:205576908-205576930 AGTCCAGGGAGATGCAGGGAGGG + Intronic
920547020 1:206826620-206826642 GAGCCAGGGAGTTCCTGGGGAGG - Intronic
920897909 1:210075792-210075814 AGGGCAGGGAAGTGCTGGGAAGG - Intronic
922101588 1:222481816-222481838 AGGCCAGGGAGTTGCTGGGTGGG - Intergenic
922101645 1:222482119-222482141 GAGCCAGGGAGTTGCTGGGTGGG - Intergenic
922103900 1:222496737-222496759 AGGCCAGGGAGTTGCTGGGCTGG - Intergenic
922262669 1:223956932-223956954 AGGCCAGGGAGTTGCTGGGTGGG - Intergenic
922262725 1:223957235-223957257 GAGCCAGGGAGTTGCTGGGTGGG - Intergenic
922264221 1:223969268-223969290 AGGCCAGGGAGTTGCTGGGCTGG - Intergenic
922421208 1:225462209-225462231 AGGCCATGGGGTGGCAGGGTAGG - Intergenic
924065122 1:240213335-240213357 AGGCCAAGGAGTTGCTGAATAGG - Intronic
924344508 1:243061933-243061955 AGGCCAGGGAGTTGCTGGGTGGG - Intergenic
924344563 1:243062236-243062258 GAGCCAGGGAGTTGCTGGGTGGG - Intergenic
924346070 1:243074261-243074283 AGGCCAGGGAGTTGCTGGGCTGG - Intergenic
1062898735 10:1125695-1125717 TGGCCAGGCAGAAGCTGGGTTGG + Intronic
1063674834 10:8131669-8131691 AGGCCAGGTGGTGGCTGGGTTGG - Intergenic
1063959884 10:11298266-11298288 AGGCCAGGGTGCTGCTGTGGGGG - Intronic
1064898227 10:20262910-20262932 TGTCCAGGGAGTTGCTGAGTTGG - Intronic
1066429672 10:35339303-35339325 AGGCCTGAGAATTGCTGGCTGGG + Intronic
1066730276 10:38430559-38430581 AGGCCAGGGAGTTGCTGGGCTGG + Intergenic
1066731768 10:38442836-38442858 GAGCCAGGGAGTTGCTGGGTGGG + Intergenic
1066731825 10:38443139-38443161 AGGCCAGGGAGTTGCTGGGTGGG + Intergenic
1067616725 10:47762835-47762857 GGGCCAGGGACTGGCTGGGGCGG - Intergenic
1067630476 10:47960071-47960093 AAGCCAGGCAGTTGTTGTGTGGG - Intergenic
1069623588 10:69852968-69852990 AGGCAAGGGCTTTGCTGGGGAGG - Intronic
1069855375 10:71437880-71437902 AGATGAGGGTGTTGCTGGGTGGG - Intronic
1069925393 10:71846994-71847016 AGGGCGGGGTGTTGCTGGCTGGG - Intronic
1070556793 10:77534097-77534119 AGGCTAGGGAGAAGCTGGGGAGG - Intronic
1070720255 10:78752055-78752077 AGGGCAGGGAGAGGCTGGGCAGG - Intergenic
1070769650 10:79074800-79074822 AGGCCAGGGAGCAGCCGGGCAGG + Intronic
1070782699 10:79146780-79146802 GTGCCAGGGGTTTGCTGGGTGGG - Intronic
1071430226 10:85601372-85601394 GGGGCAGGGAGTTGCGAGGTGGG - Exonic
1072608438 10:97001788-97001810 AGGCCAGGGAGGGCCTGGGAAGG + Intronic
1072893709 10:99347689-99347711 AGGTCAGGGAGTTGAGGGGTAGG - Intronic
1073012355 10:100371402-100371424 TGGCCAGGGTGTAGCTGGCTGGG - Intergenic
1073206215 10:101770787-101770809 AGGACAGGAAGTTGCCGGGTGGG - Intronic
1074323971 10:112429951-112429973 AGGCCAAGCAGTTGTTGGGGGGG + Intergenic
1075453787 10:122571570-122571592 AGCACAGGGATTTGCTGGGTTGG - Intronic
1075678251 10:124312756-124312778 AGTTCAAGGTGTTGCTGGGTTGG + Intergenic
1076890484 10:133280878-133280900 GGGCCAGGGCGGTGCTGGGCAGG + Intronic
1076972669 11:146126-146148 AGGCCAGGGAGTTGCTGGGCTGG - Intergenic
1077096899 11:802841-802863 AGGCCAGGAGGTTGCTGTGCAGG + Exonic
1077120062 11:903173-903195 ATGGAAGGGACTTGCTGGGTGGG - Intronic
1077185075 11:1232203-1232225 GGGACAGGAAGGTGCTGGGTGGG - Intronic
1077487995 11:2847931-2847953 TGGGCAGGGTGTTGCTGGGCAGG - Exonic
1077768819 11:5191748-5191770 AGGACAGGGAGAAGCAGGGTAGG - Intergenic
1078086619 11:8237238-8237260 AGGCCCGGGAACTGCAGGGTAGG + Intronic
1078294822 11:10057290-10057312 TGTCCAGGGTGTTGCTGAGTTGG - Intronic
1078510256 11:11979570-11979592 AGGCCAGGAAGTTGGTGAGGAGG + Intronic
1079112091 11:17610683-17610705 AGGCCAGAGAGGAGCTGGGAGGG - Exonic
1081620548 11:44616812-44616834 AGGCCAAGGGGTTGCTTGGAAGG + Intronic
1081954871 11:47082722-47082744 AGGACTGGGAGTTTGTGGGTGGG - Intronic
1082261949 11:50083271-50083293 AGGCCAGGGAGTTGCTGGGGGGG - Intergenic
1083141942 11:60729384-60729406 AGGCCACAGGGTTGCTGGGCTGG - Exonic
1083831368 11:65236046-65236068 AGGACAGGGAGGTGCAGAGTGGG + Intergenic
1084057522 11:66645838-66645860 AGGCCAGAGAGTAACTGGGGAGG - Intronic
1084425832 11:69084153-69084175 AGGCCAGGGAAGTACAGGGTCGG + Intronic
1084431404 11:69113484-69113506 AGAACAGGGAGTTGCCGGGAGGG - Intergenic
1084581281 11:70024935-70024957 GAGCCAGGGAGTTGTGGGGTGGG + Intergenic
1084700694 11:70784730-70784752 GGTCCAGGGAGATGCTGGGTGGG + Intronic
1084883872 11:72190759-72190781 AGGAAAGAGAGCTGCTGGGTGGG + Intronic
1084934261 11:72578671-72578693 GAGGCAGGGAGTGGCTGGGTTGG + Intronic
1089495592 11:118907319-118907341 AGGCGAGGCAGTTGCAGTGTAGG + Intronic
1090197622 11:124830565-124830587 AGCCCAGGGATTTGCTAGTTTGG + Intergenic
1090405392 11:126473218-126473240 TGGACAGGGAGTTGATGGGGAGG - Intronic
1092181583 12:6450462-6450484 AGGCCTGAGAGGTGCTGGATGGG - Intronic
1093164298 12:15788505-15788527 AGGGCAGGGAGTACATGGGTGGG + Intronic
1093314747 12:17634360-17634382 TGGCCAGGCAGTTGCTCTGTGGG + Intergenic
1095824315 12:46515947-46515969 TGTCCAGGGAGTTGCTGAGTTGG + Intergenic
1096069079 12:48764743-48764765 CGGCCAAGCAGTTGCTGGGCTGG + Intergenic
1096996224 12:55839942-55839964 AGAGCAGGGAGTGGCTGGGAAGG - Intronic
1099719500 12:86342380-86342402 TTTCCAGGGAGTTGCTGAGTTGG - Intronic
1103443541 12:120980011-120980033 AGGTCAGGGAGCCGCTGGGGAGG - Intronic
1103915975 12:124375952-124375974 AGGTGAGGCAGGTGCTGGGTTGG - Intronic
1104339423 12:127933978-127934000 AGGCCAGGGGGATGCTGGTGAGG - Intergenic
1104971550 12:132533089-132533111 ACTCCAGGGAGAGGCTGGGTTGG - Intronic
1104971559 12:132533132-132533154 ACTCCAGGGAGAGGCTGGGTCGG - Intronic
1104971568 12:132533175-132533197 ACTCCAGGGAGAGGCTGGGTCGG - Intronic
1104971584 12:132533240-132533262 ACTCCAGGGAGAGGCTGGGTCGG - Intronic
1104971603 12:132533326-132533348 ACTCCAGGGAGAGGCTGGGTCGG - Intronic
1104971613 12:132533369-132533391 ACTCCAGGGAGAGGCTGGGTCGG - Intronic
1104971632 12:132533455-132533477 ACTCCAGGGAGAGGCTGGGTCGG - Intronic
1104992707 12:132635121-132635143 TGGCCAGAGAGTGGCTGGGTGGG - Intronic
1105378347 13:19864160-19864182 AGGCCGGGGAGGTGCTGGAGCGG + Intergenic
1105922950 13:24982508-24982530 AGGCCAGTGCTTTGCAGGGTGGG - Intergenic
1107114007 13:36726975-36726997 AGACCAGGAAGGTCCTGGGTGGG - Intergenic
1108617208 13:52145271-52145293 AGGCCTGGCAGTTTCTGGGAAGG - Intronic
1109044275 13:57388460-57388482 CAGCCAGTGTGTTGCTGGGTGGG + Intergenic
1109509465 13:63351151-63351173 AAGCCATGGATTTGCTGGGCAGG + Intergenic
1112034267 13:95483102-95483124 AGGCCTGGGAGCTGCTGAGGAGG + Intronic
1112326142 13:98443899-98443921 AGGCCAGGGAGTGGCGGGCACGG + Intronic
1113011747 13:105775377-105775399 AGGCCAGTGAGATCCTGGGGTGG + Intergenic
1113650344 13:112029940-112029962 AGGCAATGGGTTTGCTGGGTCGG - Intergenic
1115199861 14:30841307-30841329 AGGGGAGAGAGTGGCTGGGTTGG - Intergenic
1117163447 14:53011338-53011360 AAGCGAGGGAGTGGCTGGCTGGG - Intergenic
1117348716 14:54859696-54859718 AGGCCAAGGACTTGCTTGTTAGG + Exonic
1118836780 14:69483870-69483892 AGGCCAGGGAGATGCCGGCCGGG - Intergenic
1119536840 14:75409615-75409637 AGGCCAGGGAGTGACTGACTGGG + Intergenic
1119539459 14:75428666-75428688 GGGCCAGGGAGGTGCGGGGTTGG + Intronic
1119720316 14:76885554-76885576 AGGCCAGGGAGTGGCAGAGCCGG - Intergenic
1120700415 14:87692839-87692861 TGGACAGGCAGTTGCTGGGCAGG - Intergenic
1121119063 14:91364555-91364577 AGGCCAGGGTGTTGTCAGGTGGG - Intronic
1121529353 14:94641545-94641567 AGGCCAGGGAGATGCTCACTGGG - Intergenic
1121857351 14:97282276-97282298 TGGCCTGGAGGTTGCTGGGTTGG + Intergenic
1122084400 14:99289818-99289840 AGGCCAGGGAGAGGCGGGGGAGG + Intergenic
1122592875 14:102868056-102868078 TGGGGAGGTAGTTGCTGGGTGGG - Intronic
1122981895 14:105195830-105195852 GGGCCAGGGCTTTGCTGGGAAGG + Intergenic
1124495099 15:30181471-30181493 AGGCCAGGTAGGGGCTGAGTGGG - Intergenic
1124748470 15:32357174-32357196 AGGCCAGGTAGGGGCTGAGTGGG + Intergenic
1125741180 15:41965983-41966005 AGGGCAAGGAGCTGCAGGGTAGG - Intronic
1125933351 15:43615628-43615650 AGGCCCAGGGGATGCTGGGTCGG - Exonic
1125946449 15:43715090-43715112 AGGCCCAGGGGATGCTGGGTCGG - Intergenic
1128301237 15:66567574-66567596 AGGCCAGGGGGTGGGTGGGGTGG + Intergenic
1129104416 15:73296308-73296330 GGGCCAGGGAGAAGCTGGGCAGG - Intronic
1129840306 15:78739577-78739599 AGGCCAGGTGGCTGTTGGGTGGG - Intergenic
1130540513 15:84817890-84817912 AAGCCAGGGAGTAGCAGGGTAGG - Intronic
1130620055 15:85453241-85453263 TGTCCAGGGAGTTGCTGAGTTGG + Intronic
1131005048 15:88971089-88971111 AGGCCAAGGAGGTGCTGAGAGGG + Intergenic
1131026004 15:89142150-89142172 AGGCTAGGGAGTTCATGGCTTGG - Intronic
1131144645 15:90002770-90002792 AGGCCAGGGAGGTGCTTGTGTGG + Intronic
1131508774 15:93037415-93037437 AGGCCAGGGCGTGGCGGGGTAGG + Intronic
1132100850 15:99021912-99021934 AGGCCTGGGAGTGCCTGGGGAGG + Intergenic
1133393597 16:5428734-5428756 AGGCCAGGAGGTTTCTGGGTTGG + Intergenic
1133733573 16:8596659-8596681 ATGCCAGAGAGTGGGTGGGTGGG + Intergenic
1133816175 16:9199007-9199029 AGGCCAGGGAGGTGGTCGGGGGG - Intergenic
1133976270 16:10601755-10601777 GGGCCAGGGAGGGGCAGGGTGGG - Intergenic
1135877261 16:26214294-26214316 TGGCCAGGGAGTTGAAAGGTTGG + Intergenic
1136637883 16:31537447-31537469 TGGCCAGGGAGTCGCGGAGTGGG - Intergenic
1138270479 16:55692386-55692408 AGGGCAGGGAATGGCTGGGGTGG - Intronic
1139505471 16:67396224-67396246 AGGCCAGGGGGTTGCAGGAGTGG + Intronic
1140482171 16:75267583-75267605 GGGCCAGGGTGGTGGTGGGTGGG - Intronic
1141440278 16:84025625-84025647 AGGCCTGGTGGCTGCTGGGTGGG - Intronic
1141771894 16:86094500-86094522 TGGCCTGGGAGCTGCTGGATTGG + Intergenic
1142235351 16:88919841-88919863 AGGCCCAGGAGTTGCAGTGTGGG - Intronic
1142307671 16:89294655-89294677 AGACCATGGTGTCGCTGGGTTGG - Intronic
1142396971 16:89837580-89837602 ACGCCAGGCAGGGGCTGGGTCGG + Intronic
1142447580 16:90151396-90151418 AGGCCAGGGAGTTGCTGGGCTGG + Intergenic
1142459913 17:83927-83949 AGGCCAGGGAGTTGCTGGGCTGG - Intergenic
1142605964 17:1081178-1081200 AGTCCAGGTAGTTCCTGGGTTGG + Intronic
1143401830 17:6651270-6651292 ACGCCAGGGAGCTGGTGGGGTGG + Intronic
1143578192 17:7807412-7807434 AGGTGAGGGGGTTGGTGGGTTGG + Intronic
1143633169 17:8150274-8150296 AGGCAATGGAACTGCTGGGTGGG + Exonic
1143776763 17:9204688-9204710 AGGGTAGGGAGTTGCTTAGTGGG - Intronic
1143779274 17:9220947-9220969 AGGCCAGGGAGGGGGTGGGTGGG + Intronic
1143863069 17:9905201-9905223 CGGCTGGGGAGTCGCTGGGTGGG + Exonic
1143977162 17:10838343-10838365 AGGACCTGGAGTTTCTGGGTTGG + Exonic
1144798587 17:17910138-17910160 GGGTCAGGGAGTAGCAGGGTGGG + Intronic
1146006081 17:29161591-29161613 TGGCCAGGGTTTAGCTGGGTGGG + Intronic
1146567226 17:33923904-33923926 CTGCCATGTAGTTGCTGGGTGGG - Intronic
1148065375 17:44865358-44865380 AGGTGAGGGAGTTTCTGAGTGGG - Intronic
1148147330 17:45373996-45374018 AGGCTGGGGAACTGCTGGGTTGG - Intergenic
1148765344 17:50035547-50035569 AGGCCAGGGAGGTGAGGGGGGGG + Intergenic
1148820286 17:50356020-50356042 AGGCCAGGGAGGGCGTGGGTTGG + Intronic
1149300188 17:55298096-55298118 ATGCCAGGCAAATGCTGGGTGGG - Intronic
1149574892 17:57704726-57704748 AGGCCAGTCAGTTGCAGGGATGG - Intergenic
1150218447 17:63482916-63482938 AGGCCAGGGAGATGCAGAGAAGG - Intergenic
1151251361 17:72838095-72838117 AGACAAGGGTGTTGCTGTGTTGG - Intronic
1151653835 17:75486221-75486243 TGGCCTGGGGGCTGCTGGGTGGG + Intronic
1152210770 17:79001888-79001910 AGGACAGGGAGTTCCTGAGGAGG - Intronic
1152231070 17:79114446-79114468 AGCCCAGGAGGTGGCTGGGTGGG + Intronic
1152277225 17:79364905-79364927 TGCCCAGGGAGTGGCTGGGCAGG + Intronic
1152277417 17:79366310-79366332 AGGTCAGGGAGTCACTGGCTGGG - Intronic
1152691891 17:81722128-81722150 CACCCAGGGAGTGGCTGGGTAGG + Intergenic
1152782614 17:82232872-82232894 AGGCCAGGTTATTTCTGGGTGGG + Intronic
1152822133 17:82442788-82442810 AGGCCCAGGAATGGCTGGGTAGG - Exonic
1153253754 18:3149972-3149994 AGGGCAGGAAGTTGGAGGGTTGG + Intronic
1153331467 18:3879468-3879490 AGCCCGGGGAGGTGCTGGGCCGG + Exonic
1153750976 18:8230261-8230283 AGAACAGAGAGTGGCTGGGTAGG + Intronic
1153785372 18:8529314-8529336 TTTCCAGGGAGTTGCTGAGTTGG - Intergenic
1153894175 18:9543865-9543887 GGGCCAGGCAGGTGCTTGGTGGG - Intergenic
1154201285 18:12302398-12302420 AAGCCAGGGGGTCCCTGGGTCGG + Intergenic
1155791173 18:29972120-29972142 ATGGAAGGGAGTTGCTGGGAGGG - Intergenic
1156460699 18:37319856-37319878 AGCCCAGGGTGTGGCAGGGTTGG + Intronic
1156760615 18:40584101-40584123 GGGGCAGGGAGGTGCTGGGAAGG - Intergenic
1157535102 18:48452144-48452166 GGGCCAGGGAAATGCTGGGAAGG - Intergenic
1157804082 18:50645060-50645082 AGGCCAGGGAGTGGGTGGCTGGG + Intronic
1157893218 18:51438655-51438677 AGGCCAGGGATGGTCTGGGTTGG + Intergenic
1158413961 18:57232937-57232959 AGGCCAGGGCTCTGCTGTGTAGG - Intergenic
1158494477 18:57942143-57942165 GGGCCAGGGAGCTGCAGGGATGG + Intergenic
1159032470 18:63245516-63245538 AGACAAGGGAGTTTCTTGGTAGG + Intronic
1160181944 18:76644473-76644495 TGTCCAGGGAGATGCTGAGTTGG + Intergenic
1160649628 19:216435-216457 AGGCCAGGGAGTTGCTGGGCTGG - Intergenic
1161207269 19:3047436-3047458 AGGCCAGGCCGTGGCTGAGTAGG + Intronic
1161237749 19:3206202-3206224 AGGCCAGTGGGTGGGTGGGTGGG + Intronic
1161507059 19:4649824-4649846 AGGCACGGGAATTGCTGGATGGG - Intronic
1161869646 19:6860420-6860442 AAGCCAGGGAGTTGCTTTTTGGG + Intergenic
1161983121 19:7640822-7640844 AGCCTAGGGTGTTGGTGGGTGGG + Intronic
1162054132 19:8052698-8052720 CGGGCAGGGGGTGGCTGGGTGGG + Intronic
1162430898 19:10627813-10627835 AGGACTTGGAGTTGCAGGGTAGG + Intronic
1163689700 19:18731889-18731911 AGGAGAGGGGGTTCCTGGGTCGG - Intronic
1165426751 19:35750140-35750162 AGGCCATGGGGTTGGTGGGCTGG + Intronic
1166008456 19:39924259-39924281 GGGCCATGGAGTTGGAGGGTGGG - Intronic
1166559300 19:43721098-43721120 AGGCCACGGAGTTGCATCGTCGG - Intergenic
1167342738 19:48925466-48925488 AGGCCAGGGATGGGCAGGGTGGG + Intergenic
1167780205 19:51594099-51594121 AGGGCAAGGACTTGCGGGGTGGG - Intergenic
1168353053 19:55687398-55687420 AGGCCCGGGTGTTGCTGGCTGGG + Intronic
1202714424 1_KI270714v1_random:34184-34206 AGGGCAGGGCAGTGCTGGGTGGG - Intergenic
925389227 2:3484218-3484240 GGGCTAGGGGCTTGCTGGGTGGG - Intronic
928006433 2:27566388-27566410 AGGCAATGTAGTTTCTGGGTGGG + Intronic
928111659 2:28515355-28515377 AGGCCAGGGAAGTGGTGGGCAGG - Intronic
928675307 2:33645624-33645646 TGGACGGGTAGTTGCTGGGTAGG - Intergenic
929603859 2:43221909-43221931 AGGCCAGGCTTTTTCTGGGTCGG - Intergenic
929747772 2:44676668-44676690 ATGCCAGTGAGTGGCTGGGCTGG - Intronic
930030889 2:47057387-47057409 AGGCCAGGGCCTTGCTGGGCTGG - Intronic
932072174 2:68631677-68631699 AGGCCAGGGAGTTGAGGGCAAGG + Intergenic
932335534 2:70928981-70929003 AGGACGGGGAGGTGCTGGCTTGG + Intronic
933337937 2:80984141-80984163 AGGGCAGGAAGCTCCTGGGTGGG - Intergenic
933759183 2:85662450-85662472 AGGCTTGGGAGTTGCTGAGCAGG + Intronic
933875269 2:86614251-86614273 AAGCTAGGGACTTACTGGGTAGG - Intronic
934972378 2:98773891-98773913 AGCACAGGGAGGTGCTGGGATGG - Intergenic
935617640 2:105102560-105102582 GGGCCAGGGCATTGCTGGGGAGG + Intergenic
936228199 2:110677824-110677846 AGCCCACGGCCTTGCTGGGTGGG + Intronic
937198539 2:120181367-120181389 AGGCCAAGGAGCTGTTGGGATGG + Intergenic
937322682 2:120970411-120970433 AGGCCACGGGGTTGATGGGGTGG - Exonic
937789498 2:125943426-125943448 AGGCCAAGGAGGTGCTGAGAAGG + Intergenic
939106042 2:137950030-137950052 AACCCAGGGAGCTGCTGGCTTGG + Intergenic
941642367 2:168002496-168002518 AGCACAGGGAGTGGCTGGGCTGG + Intronic
941748238 2:169109819-169109841 GGGCCAGGGTGTTGCGGGGAGGG - Intergenic
942043990 2:172088405-172088427 ATGCCGGGAAGTTGCTGGGCCGG - Exonic
942173667 2:173310652-173310674 AGGCCAGGGAGAGGTTGGGTTGG + Intergenic
942715111 2:178882857-178882879 AGGGCAGGGAGTTGAGGGGATGG + Intronic
942936722 2:181566053-181566075 ACTCCAGGGATTTGATGGGTAGG - Exonic
943390105 2:187255943-187255965 AGGACTGGAAGTTGCTGTGTGGG - Intergenic
943588998 2:189774848-189774870 AGGCCAGGTAGGAGTTGGGTGGG + Intronic
946152841 2:217787757-217787779 AGGCCAAGGAGGTGCTGAGAGGG + Intergenic
946374427 2:219299517-219299539 AGGCAAGGAAGATGCTGGGTGGG + Intronic
946412249 2:219521244-219521266 AGGCCACGGGGCTGCTGAGTGGG - Intronic
948189004 2:236044225-236044247 GGGCCTGGGACATGCTGGGTTGG - Intronic
948264980 2:236629407-236629429 AGACCAGGGGGCTGCTGGGTGGG + Intergenic
1169727909 20:8755909-8755931 TGGACAGGGAGTTGCTAGGCAGG + Intronic
1170131340 20:13023193-13023215 GGGCCAGGAAGTTGGGGGGTGGG - Intronic
1170352178 20:15453796-15453818 AGACCAGACACTTGCTGGGTAGG - Intronic
1171392911 20:24812456-24812478 TGGCATGGGAGCTGCTGGGTGGG - Intergenic
1172700664 20:36851997-36852019 TGGCCTGGGTGTTGCTGGGCTGG - Intronic
1173056957 20:39623986-39624008 AGGCCAGGGAGTGAATGTGTGGG - Intergenic
1175206769 20:57317295-57317317 AGTCCAGGGGGTTTCAGGGTGGG + Intergenic
1175497020 20:59422361-59422383 ATGCAAGGCAGGTGCTGGGTGGG + Intergenic
1175619807 20:60433929-60433951 TGGACAGGAAGTTGCTGGGCAGG + Intergenic
1175809933 20:61852466-61852488 AGGCATGGGAGGTCCTGGGTGGG + Intronic
1176046840 20:63097201-63097223 AGGCCAGGGTGGGGCTGGGGTGG + Intergenic
1176123574 20:63465105-63465127 AGGCCACAGAGCTGCTGGGACGG - Intronic
1178199776 21:30390592-30390614 GGGGCAGGGAAGTGCTGGGTAGG + Intronic
1179021325 21:37643540-37643562 GGGCCAGGGAGTTGCTGCACGGG + Intronic
1179294803 21:40052150-40052172 AGGCCAGGGAGTGGTTGGAAGGG - Intronic
1179543682 21:42100711-42100733 AGGGCACGGGGTTGCTGGGGTGG - Intronic
1179543696 21:42100745-42100767 AGGGCATGGGGTTGCTGGGGTGG - Intronic
1179543724 21:42100813-42100835 AGGGCACGGGGTTGCTGGGGTGG - Intronic
1179543767 21:42100914-42100936 AGGGCATGGGGTTGGTGGGTGGG - Intronic
1179646524 21:42779423-42779445 AGGGCAGGGAGTCCCAGGGTGGG - Intergenic
1180158588 21:45989335-45989357 CTGCCAGGGAGGGGCTGGGTGGG + Intronic
1180246330 21:46550479-46550501 AGGCTGGGGAGATGCTGGGTGGG - Intronic
1180980878 22:19877442-19877464 AAGCCAGGGCGTGGCTGGGTGGG - Intronic
1181796134 22:25312375-25312397 AGGCCAGGGGGCTGCAGGGCAGG + Intergenic
1181836680 22:25615985-25616007 AGGCCAGGGGGCTGCAGGGCAGG + Intronic
1181842795 22:25679006-25679028 AGGCCAGTGAGTTCTTGGGTGGG + Intronic
1182011369 22:27003420-27003442 AGGCCATGGAATTGGAGGGTAGG - Intergenic
1182023417 22:27099768-27099790 TGTCCAGGGCGTTGCTGAGTAGG + Intergenic
1182490089 22:30665923-30665945 ATTCCAGGGAGGGGCTGGGTGGG + Intronic
1182522101 22:30890556-30890578 GGGCCAGGGAGGTGATGGCTTGG + Intronic
1182710349 22:32318805-32318827 AGGACAGGGAGGTGATGGGGTGG - Intergenic
1182964343 22:34507198-34507220 AGACCAGGTGGTAGCTGGGTGGG + Intergenic
1183051490 22:35265508-35265530 AGGCCAGGAAGTGGCAGGGGAGG - Exonic
1183348500 22:37320832-37320854 AGGCCAGGGCATTTCTGGATGGG - Intergenic
1183599000 22:38829255-38829277 AGGGCAGGGTGTTCCAGGGTAGG + Intronic
1183603957 22:38857972-38857994 AGGCCTGAGAGTTGTAGGGTGGG - Intergenic
1183971997 22:41484399-41484421 AGGCCAGGGAGCTGGTGGATGGG + Intronic
1184397917 22:44255770-44255792 AGGACAGGGAGGTGATGGGGTGG - Intronic
1184862038 22:47177672-47177694 ATGCCAAGGAGCTGCAGGGTGGG - Intergenic
949130802 3:498324-498346 AGCCCAAGCAGTTGCTGGGAAGG - Intergenic
950025874 3:9819630-9819652 AGGGCAGGCAGTGGTTGGGTTGG - Intronic
950187304 3:10953031-10953053 AGGCCAGGGCTGGGCTGGGTGGG - Intergenic
950458418 3:13106250-13106272 AGCCCAGGAAGGTGCTGGGGAGG - Intergenic
950475107 3:13210096-13210118 AGCCCAGGGAGTTAGTGGGGAGG + Intergenic
951102993 3:18710840-18710862 AGGCAAAGGAGTTGTGGGGTGGG + Intergenic
951799727 3:26582510-26582532 AGGACAGGGAAGGGCTGGGTGGG - Intergenic
952149996 3:30578817-30578839 AGGCCAGGGTGTGGTGGGGTTGG - Intergenic
952199436 3:31111176-31111198 TGGCCAGGGGGTGGCTGGTTAGG - Intergenic
953063991 3:39452569-39452591 AGAGCAGTGAGTTGCTAGGTTGG + Intergenic
953492841 3:43364759-43364781 AGGCCAGGGTGTGGGTGGGACGG + Intronic
954008634 3:47614949-47614971 AGACAAGGGAGTAGGTGGGTGGG - Intronic
954659344 3:52218694-52218716 GGGCCAGGGTGGGGCTGGGTGGG - Intergenic
955687104 3:61559855-61559877 AAGCCAGGAAGTTCCTGGGGAGG - Intergenic
956657113 3:71563124-71563146 TGGCCAGGGAGTGGCTGGGGAGG + Intronic
958420527 3:93925464-93925486 TGGACAGGGAGTGGTTGGGTAGG + Intronic
961483202 3:127197087-127197109 AAGCCAAGGAGTAGGTGGGTGGG - Exonic
961646803 3:128397104-128397126 GGGCCTGGGAGATGCTGGGTGGG + Intronic
963043750 3:141087667-141087689 AGGCCAGGGAGTGGCAGAGCTGG + Intronic
965317804 3:167212354-167212376 TGTCCAGGGAGGTGCTGAGTTGG - Intergenic
965589517 3:170349196-170349218 AGGTCAGGGAGTTGGTAGGGAGG + Intergenic
966221391 3:177555014-177555036 AGGGCAAGGAGCTGGTGGGTGGG + Intergenic
966936159 3:184711237-184711259 AGGTCTGGGAGATGCTGCGTCGG - Exonic
967527468 3:190511781-190511803 AGGCAAGGGAGTTGTGGGGAAGG - Intergenic
967531521 3:190553652-190553674 AGGCCAAGGAAAGGCTGGGTTGG + Intronic
968239915 3:197070020-197070042 GGGCCAGGCAGTTTCTGGCTGGG - Intronic
968368221 3:198203696-198203718 AGGCCAGGGAGTTGCTGGGCTGG + Intergenic
968454003 4:688227-688249 AGGCCCGGGATCTGCTGGATGGG - Intronic
968496935 4:923676-923698 AGGGCAGGGAGTGGAGGGGTGGG + Intronic
968502420 4:957113-957135 AGGGCAGGAAGTTGCTGGGAGGG - Intronic
968952971 4:3704070-3704092 AGGCCAGGCAGCAGGTGGGTGGG + Intergenic
969167551 4:5329891-5329913 AGGACAGGGAATTCCAGGGTTGG - Intronic
969423733 4:7111828-7111850 TGGCCATGAAGGTGCTGGGTGGG + Intergenic
969610085 4:8222911-8222933 ATGCCAGGCAGTTGCTGAGGCGG + Exonic
970011856 4:11468149-11468171 AAGCCAGGGAGTTGGTGAGGTGG - Intergenic
971625616 4:28916408-28916430 AGACCAGAGAGTTGGAGGGTTGG - Intergenic
974088414 4:57285325-57285347 AGGGCAGAGAGTTGCCTGGTGGG - Intergenic
975385269 4:73750801-73750823 AGGCCAGGGAGGGGGTGGGGTGG + Intergenic
977142986 4:93399024-93399046 AGATTCGGGAGTTGCTGGGTGGG - Intronic
977819845 4:101458688-101458710 TGTCCAGGGTGTTGCTGAGTTGG - Intronic
979256649 4:118613424-118613446 AGGCCAGGGAGTTGCTGGGCTGG + Intergenic
979258154 4:118625463-118625485 GAGCCAGGGAGTTGCTGGGTGGG + Intergenic
979258211 4:118625766-118625788 AGGCCAGGGAGTTGCTGGGTGGG + Intergenic
979330138 4:119414802-119414824 AGGCCAGGGAGTTGCTGGGTGGG - Intergenic
979331699 4:119427121-119427143 AGGCCAGGGAGTTGCTGGGCTGG - Intergenic
980291094 4:130847975-130847997 AGGGAAGGGAGTTCCAGGGTTGG + Intergenic
981390426 4:144183691-144183713 AGGTGAGGGAGTAACTGGGTAGG - Intergenic
982364502 4:154560282-154560304 AAGCCAGAGAGCTGCTGGGCAGG + Intergenic
982606490 4:157523223-157523245 CGGGCAGGGTGTTGCTGGCTGGG - Intergenic
982646203 4:158027376-158027398 TGTCCAGGGAGTTGCTGAGTTGG - Intergenic
984168765 4:176335562-176335584 AAGCCAAGGAGTTGAAGGGTTGG + Intergenic
984890672 4:184489903-184489925 CGGCCTGGAAGGTGCTGGGTCGG - Intergenic
985724106 5:1506629-1506651 GGCCAAGGGAGGTGCTGGGTAGG + Intronic
986016394 5:3761318-3761340 AGGCCAGGGAGATGGAGGGAGGG - Intergenic
986971863 5:13346212-13346234 AGGGCAGGGAGTGGGTGGGCAGG + Intergenic
987431933 5:17845240-17845262 TGTCCAGGGAGTTGCTGAGTTGG + Intergenic
988547314 5:32170870-32170892 AGTCCAGAGAGTTGAGGGGTGGG - Intronic
989274960 5:39577674-39577696 CAGCCAGAGAGTTGCTAGGTTGG - Intergenic
990500309 5:56389967-56389989 TATCCAGGGAGTTGCTGAGTTGG - Intergenic
991654610 5:68891863-68891885 GGGCTGGGGAGTTGGTGGGTGGG - Intergenic
993557085 5:89353834-89353856 AGGTCAGGGAGTTACTGGAGGGG - Intergenic
993951973 5:94187187-94187209 GGGCTAGGGAGTTGTTGAGTAGG + Intronic
994214028 5:97116835-97116857 AGCTCAGTGAGTTGCTGAGTGGG - Intronic
994897299 5:105722105-105722127 TGCCCAGGGAGTTGCTGAGTTGG - Intergenic
997117395 5:131139803-131139825 TGGACAGGCAGTTGCTGGGCAGG - Intergenic
997950808 5:138241434-138241456 AGCCCAGGGAGTTGGTAGGGTGG - Intergenic
999136425 5:149322914-149322936 ATGACAGGGAGTTGGGGGGTGGG + Intronic
1000423291 5:161061780-161061802 TGGACAGGCAGTTGCTGGGAAGG - Intergenic
1000532755 5:162444392-162444414 GGGGCAGGGAGGTGCTGGGAAGG + Intergenic
1001116990 5:168948188-168948210 AGGCAGGGGTGTTGCTGGGGTGG - Intronic
1001952172 5:175823979-175824001 AGGCCTGGGGCTTGCTGGGGAGG + Intronic
1002283858 5:178149396-178149418 GGGCCAGCGAGTTGGTGGGCGGG - Exonic
1002727442 5:181308927-181308949 AGGCCAGGGAGTTGCTGGGCTGG + Intergenic
1005019300 6:21402326-21402348 TGGCCAGGTGGCTGCTGGGTGGG - Intergenic
1005506625 6:26474842-26474864 AGGCCAGAGAATTGCTTGGCTGG - Intronic
1005738503 6:28770692-28770714 AAGCCAGGGAGTTGCTAAGGGGG - Intergenic
1006339883 6:33440990-33441012 AGGGCAGGGAGTGGCAGGGCAGG + Intronic
1006339888 6:33441005-33441027 AGGGCAGGGAGTGGCAGGGCTGG + Intronic
1006573269 6:35023065-35023087 AGGCCAAGGGGTTGTTGGATTGG + Intronic
1007573794 6:42911745-42911767 AGCCCAGGGAGGAGCTGGCTCGG - Intergenic
1007749440 6:44063055-44063077 AGGCCAGGGCGTGCCTGTGTGGG + Intergenic
1007940068 6:45772124-45772146 GGGCCAGGGAGTGGGTGGTTAGG + Intergenic
1008332400 6:50260345-50260367 AGGGGAGAGAGTTGGTGGGTTGG + Intergenic
1008730943 6:54481566-54481588 AGGGAAGGGAAATGCTGGGTAGG - Intergenic
1011410178 6:87059631-87059653 AGGCCAGGGAGGTGGGGGGAGGG + Intergenic
1011750840 6:90453272-90453294 AGGAGAGTGTGTTGCTGGGTAGG + Intergenic
1014152218 6:118070585-118070607 AGGACTGGGTGCTGCTGGGTAGG - Intronic
1014950350 6:127547347-127547369 AGCCCAAGAAGTTACTGGGTTGG - Intronic
1017869921 6:158478641-158478663 AGGCCAGGCAGTTGCAGGGTGGG - Intronic
1018367535 6:163137341-163137363 AGGGCAGGGAGTTGCAGTGTTGG - Intronic
1018507906 6:164491236-164491258 AGGCCAGGCAGCAGCAGGGTGGG - Intergenic
1018680757 6:166263063-166263085 CGGCCCGGCAGTTCCTGGGTTGG - Intergenic
1018903042 6:168060660-168060682 AGGCCAGGGCTTTGCTGCCTCGG + Intronic
1019171547 6:170136002-170136024 AGTGCAGGGAGCTGCTGGGCTGG + Intergenic
1019270474 7:144332-144354 AGGCCAGGGAGGGGCCGAGTCGG - Intergenic
1019281407 7:202263-202285 AGGACAGGTGGCTGCTGGGTGGG + Intronic
1019281474 7:202555-202577 AGGACGGGTAGCTGCTGGGTGGG + Intronic
1019499472 7:1357851-1357873 AGCCCAGGGAGGGCCTGGGTGGG + Intergenic
1019723435 7:2587263-2587285 GGGCCAGGCAGTGGCTGTGTGGG + Intronic
1019729744 7:2623346-2623368 AGGCCAGGGAGGGGCTGGCAGGG + Intergenic
1020282368 7:6656090-6656112 AGGCACGGTAGTTGGTGGGTGGG + Exonic
1021009331 7:15442628-15442650 AGGGCAGGGAAGTGCTGGGAGGG + Intronic
1021613427 7:22479184-22479206 AGTCCTGGGGCTTGCTGGGTGGG + Intronic
1022130495 7:27400563-27400585 AGCTCAGGGAGATGGTGGGTGGG - Intergenic
1022451145 7:30516561-30516583 AGGCCCCTGAGTAGCTGGGTGGG - Intronic
1022950139 7:35330724-35330746 AGGGCAGGCAGTGGTTGGGTTGG - Intergenic
1022957485 7:35394555-35394577 TGCCCAGGGACTAGCTGGGTGGG + Intergenic
1023398624 7:39774715-39774737 AGGCCAGGGAGTTGCTGGGCTGG + Intergenic
1023400139 7:39786756-39786778 GGGCCAGGGAGTTGCTGGGTGGG + Intergenic
1023400196 7:39787060-39787082 AGGCCAGGGAGTTACTGGGTGGG + Intergenic
1023929595 7:44697238-44697260 TGGCCAGGCAGCTGCAGGGTCGG - Intronic
1024073124 7:45802811-45802833 AGGCCAGGGAGTTACTGGGTGGG + Intergenic
1024340223 7:48250219-48250241 AGGACATGGAGGTGCTGGGAGGG - Intronic
1024650207 7:51397377-51397399 AGGCCAGGGAGTTACTGGGTGGG - Intergenic
1024650265 7:51397681-51397703 GGGCCAGGGAGTTGCTGGGTGGG - Intergenic
1024651813 7:51409990-51410012 AGGCCAGGGAGTTGCTGGGCTGG - Intergenic
1025054354 7:55753026-55753048 AGGCCAGGGAGTTGCTGGGTGGG - Intergenic
1025054409 7:55753331-55753353 GGGCCAGGGAGTTGCTGGGTGGG - Intergenic
1025132404 7:56383179-56383201 AGGCCAGGGAGTTGCTGGGTGGG - Intergenic
1025132461 7:56383483-56383505 GGGCCAGGGAGTTGCTGGGTGGG - Intergenic
1025134023 7:56395771-56395793 AGGCCAGGGAGTTGCTGGGCTGG - Intergenic
1025183464 7:56837633-56837655 AGGCCAGGGAGTTGCTGGGTGGG - Intergenic
1025185611 7:56855992-56856014 GAGCCAGGGAGTTGCTGGGCTGG - Intergenic
1025686318 7:63720958-63720980 GAGCCAGGGAGTTGCTGGGCTGG + Intergenic
1025688461 7:63739334-63739356 AGGCCAGGGAGTTGCTGGGTGGG + Intergenic
1025910002 7:65820599-65820621 AGGCCAGGGAGTTGCTGGGCTGG + Intergenic
1025911528 7:65832545-65832567 AGGCCAGGGAGTTGCTGGGCAGG + Intergenic
1025911574 7:65832829-65832851 AGGCCAGGGAGTCGGTGGGTGGG + Intergenic
1025947949 7:66119089-66119111 AGGCCAGGGAGAATCTGGATGGG + Intronic
1025978075 7:66385447-66385469 AGGCCAGGGAGTTGCTGGGTGGG - Intronic
1025978126 7:66385731-66385753 AGGCCAGAGATTTGCTGGGCAGG - Intronic
1026236904 7:68535070-68535092 AGGCCACGGTGGTGGTGGGTGGG + Intergenic
1027050125 7:75016559-75016581 AGGCCAGGAAAAGGCTGGGTGGG - Intronic
1027203656 7:76080111-76080133 AGGCCAGGGAGTTGCTGGGTGGG - Intergenic
1027203705 7:76080395-76080417 AGGCCAGAGATTTGCTGGGCAGG - Intergenic
1027338748 7:77182883-77182905 AGGCCTGGGAGTGGTGGGGTTGG - Intronic
1028751713 7:94390569-94390591 ATGCCAGGCACTTACTGGGTTGG - Intergenic
1029316669 7:99721941-99721963 TGGACAGGCAGTTGCTGGGCAGG - Intronic
1029322562 7:99777671-99777693 TGGACAGGCAGTTGCTGGGCAGG - Intronic
1029382910 7:100225109-100225131 AGGCCAGGAAAAGGCTGGGTGGG + Intronic
1031627132 7:124004531-124004553 TGTCCAGGGAGTTCCTGAGTTGG + Intergenic
1032048961 7:128634190-128634212 AGGCCAGGGAGTTGCTGGGCTGG + Intergenic
1032050454 7:128646201-128646223 GGGCCAGGGAGTTGCTGGGTGGG + Intergenic
1032050511 7:128646505-128646527 AGGCCAGGGAGTTGCTGGGTGGG + Intergenic
1032084444 7:128876706-128876728 GCACCAGGGAGTGGCTGGGTGGG + Intronic
1032483320 7:132263801-132263823 ACTTCAAGGAGTTGCTGGGTAGG + Intronic
1032795406 7:135272152-135272174 AGGGCAGGGGGTGGCTGGGATGG + Intergenic
1032895838 7:136249986-136250008 ATGACAGGGAGATGCTGGGAGGG - Intergenic
1033532078 7:142274468-142274490 AGTCCAGGGAGTTGCTGAGTTGG + Intergenic
1034217301 7:149418159-149418181 AGTCCTGGGAGTGGCTGGATGGG - Intergenic
1034426769 7:151018153-151018175 AGTCTAGGGAGTGACTGGGTGGG - Intronic
1034535196 7:151721645-151721667 TGGCCAGGGAGCAGCAGGGTAGG + Intronic
1034789762 7:153957636-153957658 AGGCCAGGAAGTTTCAGTGTTGG - Intronic
1035286020 7:157807732-157807754 AGGCCAGGCATTTGCAGGGGCGG - Intronic
1035375587 7:158404858-158404880 AGGCCAGGGAGCTGGGGGCTGGG - Intronic
1035737502 8:1899020-1899042 AGGACAGGGAGATGCTGCGATGG + Intronic
1036827213 8:11986779-11986801 AAGCCAGGTAGGGGCTGGGTCGG - Intergenic
1037468531 8:19184596-19184618 AGGCCAGGGAGATGCTCAGCAGG + Intergenic
1038008184 8:23451877-23451899 AGGGAAGGGAATTGCTGGGGAGG - Intronic
1038233571 8:25729165-25729187 TGTCCAGGGAGTTGCTGAGTTGG + Intergenic
1039749708 8:40466148-40466170 AGGCCTGGGAGTATCTGGGAGGG - Intergenic
1040108691 8:43555791-43555813 AAGCCAGGGAGTTGCTAAGGGGG - Intergenic
1040306322 8:46213755-46213777 AGCCCAGGGGGTTTCTGGGATGG - Intergenic
1041321821 8:56621537-56621559 TGGACAGGGAGTTGTGGGGTGGG + Intergenic
1041938809 8:63364367-63364389 AGTCCCAGGAGTTGCTGGTTTGG - Intergenic
1042224953 8:66508147-66508169 ATCCCAGGGATTTGCTGGGACGG - Intronic
1043709918 8:83403222-83403244 AGCCCATGGAGTGGGTGGGTGGG - Intergenic
1044125913 8:88457631-88457653 TTTCCAGGGAGTTGCTGAGTTGG - Intergenic
1045594290 8:103635330-103635352 TGTCCAGGGAGTTGCTGAGTTGG + Intronic
1047235539 8:123039164-123039186 AGGCCAGAGAGATGGTGGTTTGG - Intronic
1047502353 8:125452076-125452098 CGGCCAGGGAGGTGCCTGGTGGG + Intergenic
1049274487 8:141712977-141712999 AGGCCTGGGTGTGGGTGGGTGGG + Intergenic
1049355556 8:142186545-142186567 AGGCCAGGGAAGGTCTGGGTTGG - Intergenic
1049355990 8:142188316-142188338 AGGACAGGGCCTTGCTGGGTGGG + Intergenic
1049427442 8:142543715-142543737 AGGGCAGGGAGGGGCGGGGTGGG + Intronic
1049615537 8:143574280-143574302 ATGCCAGGGTGGTGCTGGGTTGG + Intergenic
1049642961 8:143723630-143723652 AGGCCACGGGGCTGCAGGGTTGG + Intergenic
1049728568 8:144163533-144163555 AGGCCAGTGAGGTGCTGGTAGGG + Intronic
1051231341 9:14958561-14958583 AGGCTGGGGAGTGGCTTGGTTGG - Intergenic
1052192819 9:25678263-25678285 AGGCGCGGGAGTTGCTGCGGCGG - Exonic
1052311615 9:27074767-27074789 TGTCCATGGAGTTGCTGAGTTGG + Intergenic
1052743955 9:32421485-32421507 GGGCCAGGCAGTTGCAGGGTTGG - Intronic
1055611361 9:78029146-78029168 AGCCCAGGGAGTTTCTCAGTGGG - Intronic
1056004190 9:82249770-82249792 AGGGCTGGGATTTGCTGGGATGG + Intergenic
1057196757 9:93119846-93119868 AAGCCTGGGAGTTGGTGGGCAGG + Intergenic
1058282423 9:103131977-103131999 AGGCCAGGAAAAGGCTGGGTTGG + Intergenic
1058677173 9:107410201-107410223 AGTCCAGGGAGAGGCTGGCTGGG + Intergenic
1060237036 9:121871798-121871820 AGGCCAGTGAGTGGCAGGTTGGG - Intronic
1060266371 9:122113827-122113849 AGGCCAGGGGATTGCAGGGAGGG + Intergenic
1061373894 9:130212939-130212961 AGGCCTGGGGGTGGCTGGGGTGG + Intronic
1061938935 9:133873843-133873865 CTGCCTGGAAGTTGCTGGGTGGG - Intronic
1062001143 9:134216362-134216384 AGGCCAGGCAAGTGCTGGGGAGG - Intergenic
1062454146 9:136627828-136627850 GGGGCAGGGAGATGATGGGTGGG + Intergenic
1062697988 9:137885123-137885145 GGGCCTGGGCGTTGCTGGGGTGG + Intronic
1062752562 9:138266401-138266423 AGGCCAGGGAGTTGCTGGGCTGG + Intergenic
1203575076 Un_KI270745v1:1176-1198 AGGCCAGGGAGTTGCTGGGCTGG + Intergenic
1185937645 X:4276739-4276761 AGACCAGGGTGTTGAGGGGTTGG - Intergenic
1187119626 X:16391827-16391849 TGGCTAGGGAGTTGATGTGTAGG - Intergenic
1189084017 X:38001144-38001166 AGGGCAGGGAAGTGCTGGGTAGG - Intronic
1189992256 X:46606613-46606635 AGGCGAGGCAGGTGCTGGGTGGG - Exonic
1190742080 X:53295734-53295756 AGGCCTTGGAGCTGCTGTGTTGG + Intronic
1191255803 X:58279072-58279094 AGGCGAGGAAGCTGCTGGGAAGG + Intergenic
1192037768 X:67584184-67584206 GAGACAGGGAGTTTCTGGGTAGG - Intronic
1192891902 X:75399238-75399260 TGTCCAGGGAGTTGCTGAGTTGG - Intronic
1193692154 X:84659151-84659173 AGGCCATGGAAAGGCTGGGTTGG + Intergenic
1194824435 X:98544116-98544138 AGAACAGGGAGGTGCTAGGTAGG + Intergenic
1197079034 X:122389360-122389382 AGGCCAAGGAGGTGCTGAGAGGG + Intergenic
1197892236 X:131279047-131279069 TGGCCAGGGAGTGGCTGGTTGGG - Intronic
1197929288 X:131678509-131678531 AGGCAAGGGAGGAGCTGGGCTGG - Intergenic
1199142697 X:144331823-144331845 AGGGCAGGGAAGTGCTGGGAAGG - Intergenic
1199692542 X:150319670-150319692 GAGCCAGGGAGGTGCTGTGTTGG - Intergenic
1200002702 X:153070295-153070317 TGGACAGGAAGTTGCTGGGCAGG + Intergenic
1200005021 X:153079714-153079736 TGGACAGGAAGTTGCTGGGCAGG - Intergenic
1201282872 Y:12356460-12356482 AAGCCAGGGAGTTGCTAAGGGGG - Intergenic