ID: 1025132405

View in Genome Browser
Species Human (GRCh38)
Location 7:56383180-56383202
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 928
Summary {0: 13, 1: 10, 2: 11, 3: 65, 4: 829}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025132405_1025132419 27 Left 1025132405 7:56383180-56383202 CCACCCAGCAACTCCCTGGCCTC 0: 13
1: 10
2: 11
3: 65
4: 829
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025132405 Original CRISPR GAGGCCAGGGAGTTGCTGGG TGG (reversed) Intergenic
900158331 1:1212344-1212366 CAGGACAGGGAGGTGCTGGTGGG - Intronic
900187228 1:1338091-1338113 GAGGCCAGGGGGCAGCCGGGTGG + Exonic
900980207 1:6041911-6041933 AAGGCCAGGGAGCGGGTGGGAGG + Intronic
901013279 1:6212865-6212887 GAGGCCAGTTAGCAGCTGGGAGG - Intronic
901028392 1:6291604-6291626 GAGCCCAGGGAGCTACTGGCAGG - Intronic
901053910 1:6440027-6440049 GAGGGCAGGGCAGTGCTGGGTGG + Intronic
901425173 1:9178060-9178082 CAGGGCAGGGGGTGGCTGGGTGG + Intergenic
901601438 1:10426444-10426466 GAGCCCACGGAGTGGGTGGGAGG + Intergenic
901640896 1:10692494-10692516 GAGGGCAGGGAGGGGCAGGGTGG + Intronic
901799228 1:11697835-11697857 GAGGCCTAGGGGTTGCTGAGAGG + Intronic
902480384 1:16708283-16708305 GAGGGCAGGGCAGTGCTGGGTGG - Intergenic
902571790 1:17351929-17351951 GCGGTCAGGGAGGTGATGGGAGG + Intronic
902571801 1:17351963-17351985 GCGGCCAGGGAGGTGATGGGAGG + Intronic
902571817 1:17352017-17352039 GCGGCCAGGGAGGTGATGGGAGG + Intronic
902632686 1:17714865-17714887 GAAGACAGGGAGCTGCCGGGAGG + Intergenic
902642359 1:17775004-17775026 GAGGCCTGGAGGTTCCTGGGAGG + Intronic
902652566 1:17846107-17846129 GAGGGCAGGGATTTGGTGAGGGG - Intergenic
902773607 1:18660471-18660493 GAGGCCTGGGAGGTGGAGGGAGG + Intronic
902959950 1:19956232-19956254 GAGGAAAGGGAGTTGCAGGAGGG - Intergenic
903071447 1:20728849-20728871 GAGGCCAGGGACCTGCTGCATGG + Intronic
903242046 1:21989484-21989506 GAGAGAAGGGAGTTGCTGTGCGG + Intronic
903245554 1:22012672-22012694 GAGAGAAGGGAGTTGCTGTGCGG + Intergenic
903301118 1:22379406-22379428 GAGGCCAGGGAGAACCTGGGGGG + Intergenic
903660005 1:24971298-24971320 GAGGGCAGGAATCTGCTGGGGGG - Intergenic
903847534 1:26287400-26287422 GAGGGCAGGTAGATGCTGGCTGG + Intronic
903892464 1:26578832-26578854 GAGTCCAGTGAGTCCCTGGGGGG - Intergenic
903981635 1:27192874-27192896 TTGGGCAGGGAGTTGCAGGGTGG + Intergenic
904030961 1:27533181-27533203 GAGGCCAGGGCCTAGCTGGCTGG + Intergenic
905404302 1:37722862-37722884 CAAGCCAGGGACTTTCTGGGTGG + Intronic
905507880 1:38494535-38494557 TAGGCCAGGAAGTGGCTTGGAGG - Intergenic
905940896 1:41862511-41862533 GAGGCAGAGGAGGTGCTGGGTGG - Intronic
906690597 1:47790413-47790435 CAGGCCTGGGTGATGCTGGGGGG - Intronic
906706456 1:47898478-47898500 GAAGCCAGGGAGGCACTGGGTGG + Intronic
906807700 1:48795293-48795315 GAGCCCAGAGAGTTGGTAGGGGG - Intronic
906978628 1:50604228-50604250 GGGGCAAGGGAGATGCTGAGTGG - Intronic
907250353 1:53134061-53134083 AAGGCCAGGGAGTTGAGGGTTGG - Intronic
907281299 1:53349003-53349025 GAGGCCAGGGAGCTCGTGTGAGG + Intergenic
907441767 1:54483160-54483182 GAGGCGAGAGGGTTGCTAGGAGG - Intergenic
907477498 1:54715393-54715415 GAGGCCTGGGAGTGACTAGGAGG - Intronic
908328240 1:63044618-63044640 GGGGGCAGGGAGCTGGTGGGTGG - Intergenic
908523907 1:64969404-64969426 GAGGGTGGGGAGTTGCGGGGGGG - Intergenic
909377038 1:74952132-74952154 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
909904528 1:81178692-81178714 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
910609721 1:89128126-89128148 GAGCCCATGGAGTGGGTGGGAGG + Intronic
910667834 1:89743337-89743359 GATGCCAGGGAGTTGCAAGAGGG - Intronic
910732166 1:90409899-90409921 GTTGCCAGGGATTGGCTGGGGGG - Intergenic
911133030 1:94410196-94410218 CAGGCTAGGGAGTTGCAAGGAGG - Intergenic
911305198 1:96224423-96224445 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
911659840 1:100488995-100489017 AAGGCCAGGGAGTTGGTGATGGG + Intronic
912058088 1:105631320-105631342 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
912312842 1:108640954-108640976 GAGCCCATGGAGTGGGTGGGAGG + Intronic
912552667 1:110494244-110494266 GAGGCCAGGGAGGAGCTGCAAGG + Intergenic
912819336 1:112854598-112854620 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
913581915 1:120234660-120234682 GATGCAAGCGAGTTGTTGGGAGG + Intergenic
913626260 1:120663729-120663751 GATGCAAGCGAGTTGTTGGGAGG - Intergenic
913692078 1:121289189-121289211 GAGCCCATGGAGTGGGTGGGAGG + Intronic
914145480 1:144990925-144990947 GAGCCCATGGAGTGGGTGGGAGG - Intronic
914563846 1:148846107-148846129 GATGCAAGCGAGTTGTTGGGAGG + Intronic
914608981 1:149284119-149284141 GATGCAAGCGAGTTGTTGGGAGG - Intergenic
915444192 1:155965562-155965584 GAGGCCAAGGGGGTGCTGAGAGG - Intronic
915454666 1:156032097-156032119 GAGGCAGGAGAGTCGCTGGGCGG - Intergenic
917285118 1:173415303-173415325 GAGGCAAGTGAGTGGGTGGGAGG + Intergenic
918108194 1:181431441-181431463 GATGCCAGAGATTGGCTGGGTGG + Intronic
918241993 1:182628868-182628890 GAGGCCAGGGTGCTGTTGGCTGG - Intergenic
918708978 1:187703895-187703917 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
918720869 1:187850477-187850499 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
918792003 1:188841260-188841282 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
918853174 1:189718383-189718405 GAGCCCACGGAGTGGGTGGGAGG + Intergenic
919167916 1:193918997-193919019 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
919265510 1:195259261-195259283 GTTGTCAGGGAGTTGGTGGGTGG - Intergenic
919763152 1:201110940-201110962 GAAGCGAGGGAGTTGTTTGGGGG + Intronic
919790122 1:201285296-201285318 GGGGCTAGGGAGTAGGTGGGGGG - Intronic
919854422 1:201695720-201695742 GAGGTCAGGGAATGCCTGGGAGG - Intronic
920066850 1:203275174-203275196 CAACCCAGAGAGTTGCTGGGAGG + Intergenic
920181620 1:204135269-204135291 GAAGCCAGGGATTGGATGGGAGG + Intronic
920312362 1:205056265-205056287 GAGGCAAAGGAGGCGCTGGGAGG - Intronic
920387099 1:205576907-205576929 CAGTCCAGGGAGATGCAGGGAGG + Intronic
920479399 1:206307537-206307559 GAGCCCATGGAGTGGGTGGGAGG + Intronic
920883116 1:209898885-209898907 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
921185915 1:212669381-212669403 GCGGGCAGGGAGTGGCCGGGGGG + Intergenic
921696159 1:218213912-218213934 GGGGGCAGGGAAGTGCTGGGAGG + Intergenic
921801845 1:219410927-219410949 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
921897131 1:220412707-220412729 GAGTCCATGGAGTAGGTGGGAGG - Intergenic
922101589 1:222481817-222481839 GAGGCCAGGGAGTTGCTGGGTGG - Intergenic
922101646 1:222482120-222482142 GGAGCCAGGGAGTTGCTGGGTGG - Intergenic
922119008 1:222644081-222644103 GAGGCCAGGGATTTACCTGGAGG - Intronic
922262670 1:223956933-223956955 GAGGCCAGGGAGTTGCTGGGTGG - Intergenic
922262726 1:223957236-223957258 GGAGCCAGGGAGTTGCTGGGTGG - Intergenic
922272133 1:224043799-224043821 GGGGACAGGGAGGTGCTGGTGGG - Intergenic
922746339 1:228046141-228046163 GAGGCCAGGGAGTGGCATTGAGG + Intronic
922985916 1:229865731-229865753 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
923215449 1:231844421-231844443 GAGGCCATGGCAGTGCTGGGAGG - Intronic
923219851 1:231883329-231883351 GACGGCAAGGGGTTGCTGGGGGG - Intronic
924344509 1:243061934-243061956 GAGGCCAGGGAGTTGCTGGGTGG - Intergenic
924344564 1:243062237-243062259 GGAGCCAGGGAGTTGCTGGGTGG - Intergenic
1062776089 10:149244-149266 GTGGCCTGGGAATTGCTGTGAGG + Intronic
1062938408 10:1404443-1404465 GACGCCAGGGAGACGCTGCGTGG + Intronic
1063095300 10:2903631-2903653 GAGCCCAGGGACACGCTGGGAGG - Intergenic
1063959885 10:11298267-11298289 AAGGCCAGGGTGCTGCTGTGGGG - Intronic
1064197826 10:13259881-13259903 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1064790322 10:18951364-18951386 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1065802642 10:29366454-29366476 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1066186341 10:33013567-33013589 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1066731767 10:38442835-38442857 GGAGCCAGGGAGTTGCTGGGTGG + Intergenic
1066731824 10:38443138-38443160 GAGGCCAGGGAGTTGCTGGGTGG + Intergenic
1067936770 10:50619532-50619554 GGGGCCTGGGGGGTGCTGGGAGG + Intronic
1068902151 10:62280653-62280675 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1069408418 10:68127098-68127120 GAGGCAGGGGAATTGCTTGGAGG - Intronic
1069651672 10:70053619-70053641 GAGGGCTGGGGGTTGCTGCGCGG + Intronic
1069745397 10:70711915-70711937 GAGCCCAGGGAGCGGGTGGGGGG + Intronic
1069830475 10:71279523-71279545 GAGGCCAAGGAGGTCCCGGGAGG - Intronic
1069928470 10:71867213-71867235 GAGTCCAGGGAGGTACTGGGTGG + Intergenic
1069947198 10:71995686-71995708 GAGACCAGGGAATGGCTGGTTGG + Intronic
1070814944 10:79317189-79317211 GAGGGCAGGGACTGGCTGCGGGG - Intergenic
1070824751 10:79384622-79384644 GCAGCCAGGGAGCTGCAGGGTGG - Exonic
1071003796 10:80859529-80859551 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1071037443 10:81264999-81265021 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1071430227 10:85601373-85601395 GGGGGCAGGGAGTTGCGAGGTGG - Exonic
1072727828 10:97825471-97825493 GAGGCAGGGCAGTTGGTGGGCGG + Intergenic
1072741165 10:97910775-97910797 GAGGCCAGGGAGATGAGGTGGGG + Intronic
1073012356 10:100371403-100371425 GTGGCCAGGGTGTAGCTGGCTGG - Intergenic
1073043251 10:100621517-100621539 GCCGCCAGGGAGGGGCTGGGCGG - Intergenic
1073045043 10:100632075-100632097 GAGGGGAGAGAGGTGCTGGGAGG - Intergenic
1073077435 10:100833048-100833070 GAGCCTAGGGAGGTGATGGGAGG - Intergenic
1073206216 10:101770788-101770810 GAGGACAGGAAGTTGCCGGGTGG - Intronic
1073267251 10:102235181-102235203 GGGGCCAGGGAGGCGGTGGGGGG - Intronic
1073339288 10:102732830-102732852 GAGACCAGGGAGAAGCTGAGGGG - Intronic
1074323970 10:112429950-112429972 GAGGCCAAGCAGTTGTTGGGGGG + Intergenic
1074999118 10:118782531-118782553 GAAGCCACTGAGTTTCTGGGTGG - Intergenic
1074999269 10:118783178-118783200 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1075342892 10:121661515-121661537 CAGGGCAGGAAGATGCTGGGAGG + Intergenic
1075968290 10:126631671-126631693 GAGGCCAGGGAGGTAGAGGGTGG - Intronic
1076114069 10:127883090-127883112 GAGCCTGGGGTGTTGCTGGGTGG - Intronic
1076891726 10:133288071-133288093 GAGGCCTCGGAGGGGCTGGGAGG - Intronic
1077015283 11:396553-396575 GAGGCCAGTGCTTTGCTGTGTGG + Intronic
1077185076 11:1232204-1232226 GGGGACAGGAAGGTGCTGGGTGG - Intronic
1077208729 11:1358153-1358175 GAGGCAGGGGAGTTGCTGCCTGG + Intergenic
1078079818 11:8195779-8195801 GAGTCCAGGGGCTGGCTGGGTGG + Intergenic
1078251863 11:9623120-9623142 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1078301162 11:10133389-10133411 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1078743657 11:14091412-14091434 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1079112092 11:17610684-17610706 CAGGCCAGAGAGGAGCTGGGAGG - Exonic
1079135234 11:17772740-17772762 GGGCCCAGGGAGATGCTGGGCGG + Intronic
1079166828 11:18051980-18052002 GAGGCCAGAGAGGTGCTTAGGGG - Intergenic
1079726186 11:23883516-23883538 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1081125098 11:39312107-39312129 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1081422106 11:42881658-42881680 GAGCCCATGGAGGTGGTGGGAGG - Intergenic
1081428423 11:42950161-42950183 GAGCCCATGGAGGTGGTGGGAGG - Intergenic
1081584581 11:44375671-44375693 GAGGGCATTGAGTTGCTGAGAGG - Intergenic
1081631744 11:44694126-44694148 GAGGGCAGGGAGTGCATGGGGGG + Intergenic
1081733880 11:45390527-45390549 GAGGACAGGGAGGTGCAGAGAGG - Intergenic
1081781232 11:45714460-45714482 TATGCCAGAGAGTGGCTGGGAGG - Intergenic
1081812487 11:45921930-45921952 CAGGCCAGGGAATGGGTGGGGGG - Intronic
1082261950 11:50083272-50083294 AAGGCCAGGGAGTTGCTGGGGGG - Intergenic
1082784281 11:57308506-57308528 GAGGCCAGGGAGCTGGGGGTTGG - Exonic
1082975055 11:59063031-59063053 GAAGCCAGGGAGGAGCTGCGCGG - Intergenic
1082979481 11:59106771-59106793 GAGGCTAGGGAGGAGCTGCGCGG - Intergenic
1083148391 11:60774936-60774958 GAGGCCAGGAAGCTGCAAGGAGG + Intronic
1083248184 11:61446463-61446485 GAGGGCGGGGAGCTGCAGGGAGG - Exonic
1083309037 11:61775233-61775255 GAAGCCGGGGCTTTGCTGGGAGG - Intronic
1083541598 11:63515462-63515484 GAGGTCAGGGAGTGGATGGAAGG - Intronic
1083569205 11:63747945-63747967 GAGAGCAGAGAGTGGCTGGGAGG + Intronic
1083639579 11:64138240-64138262 GAGGCCAGGGAGGCCCTGAGAGG + Intronic
1083655086 11:64225726-64225748 GCTCCCTGGGAGTTGCTGGGGGG - Intronic
1083679431 11:64344384-64344406 CAGGCCCCGCAGTTGCTGGGAGG + Exonic
1083831367 11:65236045-65236067 GAGGACAGGGAGGTGCAGAGTGG + Intergenic
1084431405 11:69113485-69113507 TAGAACAGGGAGTTGCCGGGAGG - Intergenic
1084553502 11:69862948-69862970 GGGACCAGGGAGTTGCTGGTGGG - Intergenic
1084650158 11:70484886-70484908 GAGGGCAGCGAGTGGGTGGGCGG - Intronic
1084700693 11:70784729-70784751 AGGTCCAGGGAGATGCTGGGTGG + Intronic
1085447211 11:76609114-76609136 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1087065966 11:94028353-94028375 GAGGTCATGGGATTGCTGGGTGG + Intronic
1087354576 11:97076876-97076898 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1088184764 11:107154188-107154210 GAGGGCAGGGACCTGGTGGGAGG - Intergenic
1088476000 11:110240365-110240387 AAGGCCAGGAAGTGGGTGGGGGG + Intronic
1088507379 11:110539692-110539714 GGGGGCAGGGAAGTGCTGGGAGG - Intergenic
1089373534 11:117978572-117978594 GAGCCCATGGAGTGGGTGGGTGG + Intergenic
1089760342 11:120718242-120718264 GAGAGGAGGGAGTGGCTGGGAGG - Intronic
1090808893 11:130219964-130219986 GAGGGCAGCGAGGTGCAGGGAGG + Intergenic
1091036403 11:132237804-132237826 GAGGCCTGGGACTGGCTGAGCGG - Intronic
1091356593 11:134942284-134942306 GAGGCCAGGGAGGCAGTGGGAGG - Intergenic
1091434700 12:463127-463149 GATGACAGGGAGCTGGTGGGTGG - Intronic
1091777005 12:3191192-3191214 TAGGAGAGGGAGTTGCTGAGAGG + Intronic
1092135238 12:6142472-6142494 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1092142071 12:6190955-6190977 GAGCCCACGGAGTGGGTGGGAGG + Intergenic
1092166989 12:6348378-6348400 GAGCCCAGGGGGCTGCTGAGAGG - Intronic
1093164297 12:15788504-15788526 GAGGGCAGGGAGTACATGGGTGG + Intronic
1093580992 12:20783865-20783887 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1094661320 12:32472567-32472589 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1094666523 12:32525949-32525971 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1095742535 12:45622832-45622854 TTGGCCAGGGAGCTGCTGTGTGG - Intergenic
1095861347 12:46921287-46921309 GAGGCACGAGAATTGCTGGGAGG + Intergenic
1096463089 12:51833578-51833600 GAGGCCAGGGTGTGGAAGGGAGG - Intergenic
1096803726 12:54127680-54127702 GAGCCCGGGGTGTTCCTGGGCGG + Intergenic
1097021409 12:56023140-56023162 GAGGCCAGCGACTTGCTATGTGG - Intronic
1097233843 12:57526994-57527016 GAGGCAAGGAGGTTGCTGGGAGG - Exonic
1097779785 12:63688343-63688365 AAGGCCATGGAATTGCTGGGAGG - Intergenic
1097990491 12:65826703-65826725 GAGGGCAGAGACTTCCTGGGAGG - Intronic
1098588713 12:72185321-72185343 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1098902952 12:76131856-76131878 GAACCCAGGGAGGTGTTGGGAGG - Intergenic
1099523902 12:83696371-83696393 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1099960760 12:89394802-89394824 GAGGCCAGGGTGGGGCTGGGAGG + Intergenic
1100521491 12:95379860-95379882 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1100583348 12:95956632-95956654 CATGCCAGGAAGTTGCAGGGAGG - Intronic
1100584731 12:95969410-95969432 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1101021661 12:100559657-100559679 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1101415006 12:104501270-104501292 GCTGCCTGGGAGTTCCTGGGAGG + Intronic
1101461928 12:104905597-104905619 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1101791208 12:107929490-107929512 GAGGGCAGAGAGGTGCTGAGAGG - Intergenic
1102195265 12:111021035-111021057 GAGGCCTGGGAGGTGCTAGACGG + Intergenic
1102961189 12:117094320-117094342 GGGGCTGGGGAGATGCTGGGAGG + Intronic
1103853325 12:123947236-123947258 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1103927743 12:124433134-124433156 GTGGCCAGGCTGGTGCTGGGTGG + Intronic
1104267151 12:127244273-127244295 GCGGGCAGGGAGCAGCTGGGAGG + Intergenic
1104410464 12:128553707-128553729 GAGCACAGGGAGCTGCTGTGAGG + Intronic
1104582673 12:130022330-130022352 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1104992708 12:132635122-132635144 GTGGCCAGAGAGTGGCTGGGTGG - Intronic
1105037788 12:132939029-132939051 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1105547782 13:21364468-21364490 GAGGACAAGGAGGTGCTGGGTGG - Intergenic
1105595482 13:21833899-21833921 GAGGCCAGGGAGTAACTCGAAGG + Intergenic
1105628448 13:22136935-22136957 GAGGGAAGGGAGAAGCTGGGAGG + Intergenic
1106177228 13:27341835-27341857 TGGGCCAGGGAGGTGATGGGAGG - Intergenic
1106183573 13:27388408-27388430 AGGGCCAGGGACTTGCTGGGTGG + Intergenic
1106558101 13:30827370-30827392 GATCCCAGGGAGTGGCTTGGGGG + Intergenic
1106617030 13:31339751-31339773 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1106810984 13:33358256-33358278 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1107259346 13:38472515-38472537 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1107466983 13:40660155-40660177 GACCCCAGGGAGATCCTGGGGGG + Intronic
1108099143 13:46936140-46936162 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1108435382 13:50396870-50396892 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1108708087 13:53008060-53008082 GAAGCCAGGGAGTTGGTGGTGGG + Intergenic
1108727879 13:53201533-53201555 GTGGCCAGGTAGGCGCTGGGCGG - Intergenic
1108751501 13:53452479-53452501 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1108851580 13:54737361-54737383 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1109036777 13:57272974-57272996 GAGGACAGGGATTTCCTGAGTGG + Intergenic
1109159838 13:58958267-58958289 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1109446575 13:62447984-62448006 GAGCCCACGGAGGGGCTGGGAGG + Intergenic
1110999807 13:82165032-82165054 GAGCCCACGGAGGGGCTGGGGGG + Intergenic
1112533138 13:100224134-100224156 GAGCCCAGGGAGGGGGTGGGAGG + Intronic
1112705887 13:102068749-102068771 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1113113054 13:106845241-106845263 GGGGTCAGGAAGTTGCGGGGAGG + Intergenic
1113386495 13:109853384-109853406 GCAGACAGGCAGTTGCTGGGTGG - Intergenic
1113506671 13:110821435-110821457 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1113678090 13:112221992-112222014 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1113694366 13:112333311-112333333 GAAGCCAGGCAGGGGCTGGGAGG - Intergenic
1114561124 14:23591308-23591330 GAGGCCAGGAAGGGGGTGGGGGG - Intergenic
1114618800 14:24082547-24082569 GAGGCCATGGAGCTGCTGCAGGG - Exonic
1114720282 14:24874219-24874241 GAGGGCAGGGTGTTGTGGGGAGG + Intronic
1115447314 14:33506073-33506095 GAGGATAGGGAGTGGCAGGGTGG - Intronic
1117057848 14:51931222-51931244 GAGTCCAGGGGTTTGCTGGTAGG + Intronic
1117571890 14:57056700-57056722 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1118137599 14:63045972-63045994 CAGGGCAGGGACTGGCTGGGCGG + Intronic
1118215336 14:63803349-63803371 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1118836781 14:69483871-69483893 CAGGCCAGGGAGATGCCGGCCGG - Intergenic
1118867165 14:69712712-69712734 GAGGCCAGGGAATGACCGGGTGG - Exonic
1119466181 14:74860686-74860708 GGGGCCAGGGTGCTGCTAGGGGG + Intronic
1119481758 14:74962360-74962382 GAGGCCTGGGGGATGCTGGCAGG + Intergenic
1119870669 14:78014065-78014087 GAGCCCATGGAGTAGGTGGGAGG + Intergenic
1119881109 14:78100709-78100731 GAACACAGGGAGGTGCTGGGAGG - Intergenic
1120451407 14:84671879-84671901 GAAGCCAGGGAGCTGCTTTGGGG + Intergenic
1120601497 14:86515862-86515884 GGAGCCAGGGGGTTGCTGGTGGG - Intergenic
1120779739 14:88476373-88476395 GACCCCAGAGAGTTGTTGGGGGG - Intronic
1121119064 14:91364556-91364578 GAGGCCAGGGTGTTGTCAGGTGG - Intronic
1121863585 14:97341763-97341785 GAGGCAAGGGAACAGCTGGGAGG - Intergenic
1122107355 14:99468576-99468598 GAGCCCTTGGTGTTGCTGGGAGG - Intronic
1122268771 14:100558970-100558992 GGGGCCTGGGGGTTGTTGGGGGG + Intronic
1122534215 14:102451013-102451035 GACGGAAGGAAGTTGCTGGGAGG - Intronic
1122750281 14:103928142-103928164 GAGGCCAGGGAGTGACCGGAGGG + Intronic
1124573164 15:30884032-30884054 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1125464878 15:39941090-39941112 GAACACAGGGAGGTGCTGGGAGG - Intronic
1125631621 15:41151914-41151936 GAGCCCACGGAGTGGCAGGGAGG - Intergenic
1125832717 15:42728154-42728176 CAGGCCAGGCAGTTGTGGGGAGG - Intronic
1127399531 15:58572531-58572553 GAGGGCAGGGAGCAGCAGGGAGG - Intergenic
1128110880 15:65075300-65075322 GAGCCCATGGAGTGGATGGGAGG - Intronic
1128111220 15:65077401-65077423 GAGGCCAGCACGTTGCTGGCCGG + Exonic
1128240016 15:66095530-66095552 TAGGCCAGGCAGTGGGTGGGAGG - Intronic
1128446436 15:67765477-67765499 GGGGGCGGGGAGTTGCAGGGTGG + Intronic
1128614157 15:69096446-69096468 GGGGCTAGGCAGCTGCTGGGTGG - Intergenic
1129156216 15:73719746-73719768 GAGGCCAGAGAGCTGCAAGGAGG - Intergenic
1129592779 15:76931991-76932013 GCGGCCAGGCCGGTGCTGGGAGG + Intronic
1129859202 15:78847149-78847171 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1130233302 15:82113047-82113069 AAGGGCATGGAGGTGCTGGGGGG - Intergenic
1130572270 15:85057454-85057476 GGGGTCAGGGAATTCCTGGGTGG - Intronic
1130927420 15:88396055-88396077 GAAGGCAGGGAAGTGCTGGGAGG - Intergenic
1131005047 15:88971088-88971110 GAGGCCAAGGAGGTGCTGAGAGG + Intergenic
1131507823 15:93032103-93032125 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1131977569 15:97961210-97961232 GGGGCCGGGGAGGGGCTGGGAGG + Intronic
1132845610 16:1999590-1999612 GAGCCCAGGGGGTTCCTTGGGGG + Exonic
1132855521 16:2042968-2042990 GTGGGGAGGGAGGTGCTGGGGGG - Intronic
1132896017 16:2229768-2229790 GAGACCAGGGCCTGGCTGGGAGG + Intronic
1132940071 16:2502040-2502062 GTGGCCAAGGAGGTGCTGTGTGG - Exonic
1133001507 16:2853765-2853787 GAGGCCAGGGAGAGGTTGTGGGG + Intronic
1133063291 16:3188996-3189018 GAGGCCAGGCAGGCGCTGCGGGG + Intergenic
1133209700 16:4256733-4256755 GGGGGCAGGGGGGTGCTGGGGGG + Intergenic
1133733572 16:8596658-8596680 GATGCCAGAGAGTGGGTGGGTGG + Intergenic
1133816176 16:9199008-9199030 AAGGCCAGGGAGGTGGTCGGGGG - Intergenic
1135262089 16:20989726-20989748 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1135299359 16:21312865-21312887 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1136368437 16:29820757-29820779 GAGGCCTGAGAGTTGCAGGGGGG - Intronic
1136581253 16:31152362-31152384 GAGCCCAGTCCGTTGCTGGGTGG - Intergenic
1136591948 16:31222976-31222998 GTGACCAGGCAGTTGATGGGAGG + Intronic
1137531774 16:49282457-49282479 GGTGCCCGGGAGCTGCTGGGCGG + Intergenic
1137721927 16:50632441-50632463 GAGGGCAGGGCGTGGCTGGACGG + Intronic
1140937709 16:79690374-79690396 GAGTCCAGTGAGTTGCTCAGGGG + Intergenic
1141440279 16:84025626-84025648 GAGGCCTGGTGGCTGCTGGGTGG - Intronic
1141950320 16:87335443-87335465 TAGGTCAGGCAGTTGCTGTGGGG + Exonic
1142209927 16:88804080-88804102 GAGGCCGGGGAGTTGGGGGCGGG + Intronic
1142235352 16:88919842-88919864 GAGGCCCAGGAGTTGCAGTGTGG - Intronic
1142267803 16:89072559-89072581 GTGGCCAGGAGGTTGGTGGGTGG - Intergenic
1142359201 16:89618923-89618945 GGGGGCAGGGAGCTGCAGGGAGG - Intronic
1142359245 16:89619015-89619037 GGGGGCAGGGAGCTGCAGGGAGG - Intronic
1142359272 16:89619076-89619098 GGGGGCAGGGAGCTGCAGGGAGG - Intronic
1142359284 16:89619106-89619128 GGGGGCAGGGAGCTGCAGGGAGG - Intronic
1142359312 16:89619167-89619189 GGGGGCAGGGAGCTGCAGGGAGG - Intronic
1142359353 16:89619258-89619280 GGGGGCAGGGAGCTGCAGGGAGG - Intronic
1142359381 16:89619318-89619340 GGGGGCAGGGAGCTGCAGGGAGG - Intronic
1142359466 16:89619500-89619522 GGGGGCAGGGAGCTGCAGGGAGG - Intronic
1142505703 17:361869-361891 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1142614836 17:1128079-1128101 GAGGACAGGGTGCTGGTGGGCGG + Intronic
1142809041 17:2386776-2386798 GAGGCCTGGGGGTGGGTGGGGGG + Exonic
1142919017 17:3168189-3168211 GAGGCAATGGAATTGCTGGTTGG + Intergenic
1143408523 17:6694519-6694541 GAGGCAGGAGAATTGCTGGGAGG + Intronic
1143451011 17:7036660-7036682 GAGGGGCGGGAGATGCTGGGGGG + Intronic
1143526496 17:7476119-7476141 GAGGCCAGGGGATAGCTGGGAGG - Intronic
1143779273 17:9220946-9220968 CAGGCCAGGGAGGGGGTGGGTGG + Intronic
1143863068 17:9905200-9905222 GCGGCTGGGGAGTCGCTGGGTGG + Exonic
1144543450 17:16168872-16168894 GAGGCAGGAGAATTGCTGGGAGG + Intronic
1144625912 17:16844430-16844452 GGGGCAAGGGAGGGGCTGGGCGG - Intergenic
1144723241 17:17486629-17486651 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1144880521 17:18428290-18428312 GGGGCAAGGGAGGGGCTGGGCGG + Intergenic
1144955685 17:19017789-19017811 CAGCCCAGGGAGATGCTGGAGGG + Intronic
1145151714 17:20516097-20516119 GGGGCAAGGGAGGGGCTGGGCGG - Intergenic
1145887928 17:28395828-28395850 GTAGCCAGGCAGGTGCTGGGAGG - Exonic
1145977359 17:28992058-28992080 GAGGCCAGGCAGCTGCTCTGGGG - Intronic
1146126893 17:30237399-30237421 GGGTACAGGGAGTTGCTGGGAGG + Intergenic
1146163085 17:30570378-30570400 GGGGCAAGGGAGGGGCTGGGTGG - Intergenic
1146695644 17:34907569-34907591 GAGGCCAGGGGTCTTCTGGGAGG - Intergenic
1147140618 17:38458721-38458743 GGGGCCAGGGGCGTGCTGGGAGG - Intronic
1147167169 17:38599745-38599767 GAGGGCAGGGTGTCCCTGGGTGG + Intronic
1147384678 17:40074275-40074297 GGGGCCAGGGAGTGGCAGGTGGG - Exonic
1147857008 17:43488691-43488713 AGGGCCAGGCAGCTGCTGGGTGG - Intronic
1147997567 17:44369079-44369101 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1148185859 17:45643251-45643273 GAGGTGAGGAACTTGCTGGGGGG + Intergenic
1148577563 17:48722641-48722663 GAGGCGAGGAGGCTGCTGGGAGG - Intergenic
1148765343 17:50035546-50035568 AAGGCCAGGGAGGTGAGGGGGGG + Intergenic
1149132244 17:53316479-53316501 GTGGCCAGAGAAGTGCTGGGAGG - Intergenic
1149302629 17:55318902-55318924 GAGGCAGGGGAGAGGCTGGGAGG - Intronic
1149866542 17:60154230-60154252 GAGGCCATGGGGTGGGTGGGAGG + Intronic
1150227431 17:63531584-63531606 GAGGTCAGTGAGGTGCTGAGTGG - Intronic
1150283130 17:63940827-63940849 GAGGCCAGGCAGTGTCTGAGGGG + Exonic
1150306717 17:64091749-64091771 GAGCCCAGGGAGTTGGGGCGGGG + Intronic
1151483312 17:74383210-74383232 GAGGCCAGGGAGCAGCTGGAGGG + Intergenic
1151562546 17:74878289-74878311 CAGGCCAGGGAGGGGCAGGGTGG + Exonic
1151653834 17:75486220-75486242 GTGGCCTGGGGGCTGCTGGGTGG + Intronic
1151828942 17:76538424-76538446 GAGGGCATGGAGGTGCTGGGCGG - Intronic
1152723187 17:81932800-81932822 GAGGGCAGGGAGGGGCCGGGAGG + Intronic
1152782613 17:82232871-82232893 GAGGCCAGGTTATTTCTGGGTGG + Intronic
1152807265 17:82362046-82362068 GAGGCCAGTAGGATGCTGGGCGG - Exonic
1152887506 17:82860942-82860964 GTGGCCAGGGACTTGGCGGGGGG + Intronic
1152888666 17:82867373-82867395 GAGGCTATGGAGTTGCCGGGTGG + Intronic
1152889479 17:82872303-82872325 GAGGCCAGGGAGGTCTGGGGTGG + Intronic
1153365518 18:4251371-4251393 GAGGTCAGTGAGTTGCGGGCAGG + Intronic
1153644021 18:7178751-7178773 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1154333399 18:13447973-13447995 GAGGCCAAGGGGTGGCCGGGAGG + Intronic
1154492097 18:14930329-14930351 CAGGGCAGTGAGTTTCTGGGAGG + Intergenic
1154498063 18:14977018-14977040 GAGGCCAGGGAGGCAATGGGAGG + Intergenic
1155208013 18:23577714-23577736 GAGGCCACGGAGGGGGTGGGAGG + Intronic
1155271921 18:24149638-24149660 GAGTCCACGGAGTGGGTGGGAGG + Intronic
1155772908 18:29723793-29723815 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1155791174 18:29972121-29972143 TATGGAAGGGAGTTGCTGGGAGG - Intergenic
1156114377 18:33769512-33769534 GAGGCCAGGAGATTGCAGGGTGG - Intergenic
1157086004 18:44581009-44581031 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1157433175 18:47646948-47646970 GAGGCCAGGGAGTTGAGCTGAGG - Intergenic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1157979767 18:52366988-52367010 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1158445605 18:57518007-57518029 AAGGCCAGGGAGCCGATGGGAGG + Intergenic
1158963395 18:62604324-62604346 GAGGACAGGCATTTGCTGAGAGG + Intergenic
1159230838 18:65605530-65605552 GAGCCCACGGAGGTGGTGGGAGG - Intergenic
1159656070 18:71031422-71031444 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1160317391 18:77860154-77860176 GAAGCCAGAAAGGTGCTGGGAGG + Intergenic
1160797871 19:954104-954126 GGGGCCAGGAGGGTGCTGGGGGG + Intronic
1160890239 19:1373861-1373883 GAGGCCAGGGAGGAGGTGTGGGG + Intronic
1160909446 19:1468021-1468043 GAGCTCAGGGAGTAGCAGGGCGG - Exonic
1160963521 19:1735281-1735303 GAGCCCAGGGAGGTCCTGGGAGG - Intergenic
1161040574 19:2108928-2108950 GAGGCCTGGGAGCTGGTGCGGGG - Intronic
1161335433 19:3710406-3710428 GAGGACAGGGAGCTGGTGGCGGG + Intronic
1161389262 19:4012740-4012762 GGGGGCAGGGCTTTGCTGGGAGG + Intronic
1161446427 19:4321716-4321738 GAGTCCAAGGAGTATCTGGGGGG + Intronic
1161720257 19:5898314-5898336 GAGGCTAGGGTGCTGTTGGGGGG - Intronic
1161983120 19:7640821-7640843 GAGCCTAGGGTGTTGGTGGGTGG + Intronic
1162054131 19:8052697-8052719 GCGGGCAGGGGGTGGCTGGGTGG + Intronic
1162085605 19:8247231-8247253 GAGGGCAGGGAGGTGATGAGGGG - Intronic
1162230182 19:9259789-9259811 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1162323874 19:9986858-9986880 GAGGCTAGGCAGAAGCTGGGAGG + Intronic
1162487311 19:10969129-10969151 GAGGCCAGGGAGATTCTGAGAGG - Intronic
1162520296 19:11175712-11175734 GAGGCCAGGGAGATGGGGAGAGG - Intronic
1162687683 19:12401021-12401043 GAGGCGGGGGAGGGGCTGGGTGG - Intronic
1162860989 19:13505832-13505854 GAGACCCGGGGGTTGATGGGAGG - Intronic
1163671709 19:18633264-18633286 GAGGACAGGGAGTTGATGTCGGG + Intergenic
1163703416 19:18798675-18798697 GAGCCCAGGTAGGGGCTGGGAGG - Intergenic
1164310493 19:24041590-24041612 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1165489653 19:36115749-36115771 GGGGCCGGGGAGTGACTGGGCGG + Intronic
1165907112 19:39200779-39200801 AAGGTCAGGGAGGTGCTGTGGGG - Exonic
1166075803 19:40413252-40413274 GGGTCCCGGGAGGTGCTGGGAGG - Intronic
1167096946 19:47379670-47379692 GAAGACAGGGAGTAGGTGGGAGG - Intronic
1167097207 19:47380889-47380911 GAGGCCAGGAAGATGGGGGGTGG - Exonic
1167342737 19:48925465-48925487 GAGGCCAGGGATGGGCAGGGTGG + Intergenic
1167587813 19:50384635-50384657 GTGGCCCGGGAGGAGCTGGGGGG + Intronic
1167752252 19:51388136-51388158 GAGGTCAGTGAGTGGGTGGGGGG - Intergenic
1167791841 19:51688249-51688271 GAAACCAAGGAGGTGCTGGGAGG - Intergenic
1167795510 19:51705629-51705651 GAGGCCAAGGAGGTGGTGGGGGG - Intergenic
1167963195 19:53123641-53123663 GAGGTCAGAGAGGTCCTGGGAGG + Intronic
1168306662 19:55439579-55439601 GAGGCCAGGGAGAGGGTGGTTGG - Intronic
1168353052 19:55687397-55687419 AAGGCCCGGGTGTTGCTGGCTGG + Intronic
1202714425 1_KI270714v1_random:34185-34207 GAGGGCAGGGCAGTGCTGGGTGG - Intergenic
925092440 2:1166602-1166624 GGGGGCAGGGAAGTGCTGGGAGG + Intronic
925286599 2:2720498-2720520 GAGGCGAGGGCGTTCCTGGCTGG - Intergenic
925537774 2:4935399-4935421 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
925572413 2:5325928-5325950 GGGGGCAGGGAAGTGCTGGGAGG - Intergenic
925957049 2:8977034-8977056 GAGGCCAGGGAGAGGCAGGAGGG + Intronic
926046691 2:9715246-9715268 GAGGCCACGGAGCAGCTAGGAGG - Intergenic
926737447 2:16084188-16084210 GCGGCATGGGAGGTGCTGGGAGG + Intergenic
927450854 2:23208232-23208254 GAGCCCGGGGAGTAGCTGGGAGG - Intergenic
927777827 2:25915737-25915759 GAGCCCACGGAGTGGCGGGGAGG - Intergenic
928166663 2:28977162-28977184 GAGGGCAGGGACTTGTTGGAGGG + Intronic
928714799 2:34047969-34047991 GAGCCGAGGTAGTTGGTGGGAGG + Intergenic
928858791 2:35830969-35830991 GAGGCCAGGGATGTTGTGGGAGG + Intergenic
929572038 2:43028738-43028760 GAGGCCAGGCTGTGCCTGGGTGG - Intergenic
929628440 2:43434312-43434334 GAGGGCAGGGAAGTGCTGGGAGG + Intronic
929947883 2:46384006-46384028 CAGACCAGGGAGTGGCAGGGGGG - Intronic
931229496 2:60362371-60362393 GAGGCCAGGGAGGACCTGGGAGG + Intergenic
931791160 2:65665505-65665527 GAGGACAGGTAATGGCTGGGAGG + Intergenic
931868286 2:66434253-66434275 GGGGCCGGGGAGCCGCTGGGAGG - Intronic
932095151 2:68840520-68840542 GAAGCCAGGGTGTTGCTAGACGG - Intergenic
932359489 2:71092572-71092594 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
932486513 2:72087157-72087179 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
932902083 2:75711850-75711872 GAGCCCATGGAGTGGATGGGAGG - Intergenic
933337938 2:80984142-80984164 GAGGGCAGGAAGCTCCTGGGTGG - Intergenic
933666931 2:84971486-84971508 GAGGCCCGGGAGGTGCGGGTGGG - Intronic
933703511 2:85273125-85273147 GAGCCCAGGAAGCTGCTGGTGGG - Intronic
935303942 2:101718650-101718672 GAGGCAAAGGAGGTGCTGAGAGG + Intronic
936108828 2:109648438-109648460 GAGGCAAGAGAACTGCTGGGAGG - Intergenic
936145480 2:109977955-109977977 GACCACAGGGAGGTGCTGGGAGG + Intergenic
936199206 2:110393523-110393545 GACCACAGGGAGGTGCTGGGAGG - Intergenic
936407125 2:112214744-112214766 GAGGCCAGTGATTGGCTGTGAGG + Exonic
937209562 2:120259835-120259857 GAGCCCATGGAGTGGGTGGGAGG + Intronic
937746631 2:125422524-125422546 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
937911004 2:127075681-127075703 GAGGGCTGGGAGCAGCTGGGAGG - Intronic
937982651 2:127624401-127624423 GAGGCCAGGTAGAAGGTGGGGGG + Intronic
938178728 2:129160915-129160937 GAGTCCAGGGAGATGAAGGGTGG + Intergenic
938240776 2:129741026-129741048 TGGGCCAGGGAGCAGCTGGGAGG + Intergenic
938751126 2:134331612-134331634 GACGGCAGGGGGTTGGTGGGGGG + Intronic
938775617 2:134538832-134538854 GAGACCTGGGAGGGGCTGGGTGG + Intronic
938954083 2:136282570-136282592 GAGGCCAGGCCAGTGCTGGGCGG + Intergenic
939229794 2:139410616-139410638 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
940140278 2:150485712-150485734 AAGGCCGGGGAGTGGCAGGGGGG - Intronic
941705838 2:168657523-168657545 GAGCCCATGGAGTGGGTGGGAGG + Intronic
941748239 2:169109820-169109842 TGGGCCAGGGTGTTGCGGGGAGG - Intergenic
941820828 2:169841809-169841831 GAGCCCATGGAGTGGGTGGGAGG - Intronic
944913456 2:204332991-204333013 GATTCCTGGGAGTTGTTGGGAGG + Intergenic
945132795 2:206592248-206592270 CTGGCTAGGGAGTGGCTGGGAGG - Intronic
945441298 2:209883391-209883413 GTTGCCAGGGACTTGGTGGGAGG - Intronic
945745815 2:213718767-213718789 GAGCCCATGGAGTGGGTGGGAGG - Intronic
946152840 2:217787756-217787778 GAGGCCAAGGAGGTGCTGAGAGG + Intergenic
946302412 2:218831937-218831959 GAAGGCTGGGGGTTGCTGGGAGG + Intronic
946358050 2:219201512-219201534 GAGCCCATGGAGTGGGTGGGAGG + Intronic
946374426 2:219299516-219299538 TAGGCAAGGAAGATGCTGGGTGG + Intronic
946412250 2:219521245-219521267 GAGGCCACGGGGCTGCTGAGTGG - Intronic
946851144 2:223908467-223908489 GAGGGCAGTGAGTTTCAGGGAGG - Intronic
946897505 2:224339250-224339272 GAGACAAGGGAGGTGCTGGTAGG + Intergenic
947534129 2:230930133-230930155 CTGGACAGGGAGCTGCTGGGAGG - Intronic
947541192 2:230980924-230980946 GAGGGGAGGGAGTTGCAGGGTGG + Intergenic
948106601 2:235419611-235419633 GAAGCCGTGGAGTGGCTGGGGGG - Intergenic
948205353 2:236160288-236160310 GAGGCTAGGGTGTTGATGGTGGG + Intergenic
948264979 2:236629406-236629428 GAGACCAGGGGGCTGCTGGGTGG + Intergenic
948279552 2:236736357-236736379 CAGGGCAGGGGGTGGCTGGGGGG + Intergenic
948338994 2:237233934-237233956 GAAGCCAGGAAGGTGCAGGGAGG + Intergenic
948513680 2:238489528-238489550 GAGGCCCTGGAGCAGCTGGGGGG - Intergenic
948617816 2:239212729-239212751 GACTCCAGGGAGGAGCTGGGAGG + Intronic
948647042 2:239411851-239411873 CAGACCAGGGAGGTCCTGGGGGG + Intergenic
948903583 2:240967731-240967753 GAGGCCAGGGTGGGGCAGGGGGG - Intronic
1169475910 20:5931024-5931046 GATGCCAGGGGGAAGCTGGGGGG - Intergenic
1169814419 20:9641673-9641695 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1169882760 20:10365426-10365448 GAAGACATGGAGGTGCTGGGAGG - Intergenic
1170131341 20:13023194-13023216 GGGGCCAGGAAGTTGGGGGGTGG - Intronic
1170246504 20:14226783-14226805 GAGCCCACGGAGTGGGTGGGAGG - Intronic
1170600117 20:17835628-17835650 GAGGCCAGGGGGATGTTGAGGGG + Intergenic
1170633293 20:18083405-18083427 GAGGCCAGGGAGTGGTCGGAAGG - Intergenic
1170806815 20:19639715-19639737 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1171318816 20:24220805-24220827 GAGTCCATGGAGTGGGTGGGAGG + Intergenic
1171392912 20:24812457-24812479 GTGGCATGGGAGCTGCTGGGTGG - Intergenic
1172306228 20:33882611-33882633 GAGGCCAGGCACTAGCTGGATGG + Intergenic
1172477239 20:35248139-35248161 GATCCAAGGGAGTTGGTGGGGGG + Intronic
1172847444 20:37938350-37938372 GGGGCCAGCGAAGTGCTGGGTGG + Intronic
1172899609 20:38324879-38324901 GAGGACAGGGCTTTGCTGAGTGG + Intronic
1172901752 20:38340147-38340169 GAGGAAAGGCAGTTGCTTGGGGG + Intergenic
1173195494 20:40910554-40910576 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1173195722 20:40911459-40911481 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1173565053 20:44032546-44032568 GAGGCCAGAGAGGTGCCAGGTGG + Intronic
1174189062 20:48727385-48727407 GAGGCAAGGGGGCTGCAGGGCGG - Intronic
1175521273 20:59604130-59604152 CAGGCCAGGTGGTTGCGGGGAGG + Intronic
1175913247 20:62414422-62414444 GGGGCCAGGGGGCTGCTGTGGGG + Exonic
1175931020 20:62493734-62493756 GAGGGCAGGGAGGTGTGGGGGGG + Intergenic
1176150947 20:63590408-63590430 GAGGCCGGGGAGCTGGCGGGGGG + Exonic
1176235703 20:64052541-64052563 GTGCCCAGGCAGTGGCTGGGAGG - Intronic
1176856775 21:13980645-13980667 GCGGCGAGGGAGTTGGTTGGGGG - Intergenic
1176966582 21:15218660-15218682 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1177264391 21:18764658-18764680 GAGGGCAGAGAAGTGCTGGGAGG + Intergenic
1177339457 21:19781742-19781764 GGGGGCAGGGAAGTGCTGGGAGG + Intergenic
1178398776 21:32265607-32265629 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1178482528 21:32991889-32991911 GAGGCCCGGGAGGGGCTGGGGGG + Intergenic
1178782979 21:35623835-35623857 CAGGCCAGGGAGATGCTGTAGGG - Intronic
1179021324 21:37643539-37643561 GGGGCCAGGGAGTTGCTGCACGG + Intronic
1179251343 21:39673868-39673890 GAGTGGAGGGAGCTGCTGGGAGG - Intergenic
1179294804 21:40052151-40052173 AAGGCCAGGGAGTGGTTGGAAGG - Intronic
1179501696 21:41813240-41813262 CAGCCCAGCGAGTTGGTGGGCGG + Intronic
1179543768 21:42100915-42100937 GAGGGCATGGGGTTGGTGGGTGG - Intronic
1180159817 21:45994022-45994044 GAGGCCAGGAAGGGGCTGTGCGG + Intronic
1180235792 21:46458788-46458810 GAGGCTCTGGTGTTGCTGGGCGG + Intergenic
1180246331 21:46550480-46550502 GAGGCTGGGGAGATGCTGGGTGG - Intronic
1180639820 22:17289198-17289220 GAGGCCACGCAGTTACTGGTAGG - Intergenic
1180980879 22:19877443-19877465 CAAGCCAGGGCGTGGCTGGGTGG - Intronic
1181368635 22:22399044-22399066 CAGGCCAGTGGGTAGCTGGGAGG + Intergenic
1181842794 22:25679005-25679027 AAGGCCAGTGAGTTCTTGGGTGG + Intronic
1182425693 22:30270904-30270926 GAGGACAGGGAGTGGCTCGGAGG + Intergenic
1182550408 22:31097888-31097910 GAGGCCAGTGAGTTGCTTAGGGG + Intronic
1182576864 22:31278734-31278756 ACTGCCAGGGAGTTCCTGGGTGG - Intronic
1183209576 22:36442669-36442691 GTGCCCTGGGAGTGGCTGGGTGG + Intergenic
1183505789 22:38208178-38208200 GAGGTCAGTGAGCAGCTGGGAGG - Intronic
1183603958 22:38857973-38857995 GAGGCCTGAGAGTTGTAGGGTGG - Intergenic
1183685271 22:39357875-39357897 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1183880369 22:40822073-40822095 GAGGCCAGGGGGTGGGGGGGGGG - Intergenic
1183971996 22:41484398-41484420 CAGGCCAGGGAGCTGGTGGATGG + Intronic
1183985695 22:41569009-41569031 GAGGCCATGGAGGGGCAGGGAGG - Intronic
1184168387 22:42743850-42743872 GAAGCCAGGAAGTGGCGGGGAGG + Intergenic
1184726661 22:46351212-46351234 GAAGCCAGGGAGCCGCTGTGGGG + Intronic
1184767657 22:46579962-46579984 GACACCAGGGACTGGCTGGGTGG + Intronic
1185125221 22:49006831-49006853 GAGGCCAGCGAGTGTCTGGAGGG - Intergenic
1185345378 22:50308372-50308394 GAGGCCAGGGATGTGCTGGGAGG - Intergenic
1185388957 22:50548727-50548749 GAGGCCCGGGGGTTGGGGGGTGG + Exonic
950138732 3:10600969-10600991 GAAGCTGGGGTGTTGCTGGGTGG - Intronic
950187305 3:10953032-10953054 GAGGCCAGGGCTGGGCTGGGTGG - Intergenic
950432977 3:12961803-12961825 GAGGCCATGGAGTTGTTGTGAGG - Intronic
950513332 3:13447281-13447303 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
950613490 3:14140827-14140849 GAGGCCAGGTAGTGGCTTGCAGG + Intronic
950718246 3:14864720-14864742 GAGGGGATGGAGTTGCTGGAGGG + Intronic
950929427 3:16773992-16774014 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
951146563 3:19234368-19234390 GAGCCCACGGAGTTGGGGGGAGG + Intronic
951799728 3:26582511-26582533 GAGGACAGGGAAGGGCTGGGTGG - Intergenic
952593674 3:34988653-34988675 GAGCCCAGGGAGGTGGTGGGAGG - Intergenic
953532254 3:43749273-43749295 GGGGACATGGAGTTGCTGAGTGG - Intergenic
953536686 3:43782386-43782408 GAGGGTGGGGAGTTGCAGGGTGG + Intergenic
953925593 3:46980842-46980864 GATGCCAGGCAGGTGCAGGGAGG - Intronic
954008635 3:47614950-47614972 GAGACAAGGGAGTAGGTGGGTGG - Intronic
954748742 3:52802156-52802178 GGGAGCAGGGAGTTGCCGGGGGG + Intronic
955210321 3:56934741-56934763 GAGCCCATGGAGTGGGTGGGAGG - Intronic
955266426 3:57449430-57449452 GAGCCCATGGAGTGGGTGGGAGG + Intronic
955719773 3:61868427-61868449 GAGGCCAGGGAGCTGGGGGCAGG - Intronic
956481492 3:69677729-69677751 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
956855294 3:73269469-73269491 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
957921856 3:86757877-86757899 GAGCCCACGGAGTGGATGGGAGG - Intergenic
961460498 3:127046953-127046975 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
961483203 3:127197088-127197110 GAAGCCAAGGAGTAGGTGGGTGG - Exonic
961547398 3:127644807-127644829 AAGGCTAGGGAGGTGCAGGGAGG + Intronic
961547416 3:127644867-127644889 GAGGCCAGGCAGGTGCAGGGAGG + Intronic
961646802 3:128397103-128397125 TGGGCCTGGGAGATGCTGGGTGG + Intronic
962095195 3:132285587-132285609 TAGGGCAGGGAAGTGCTGGGCGG - Intergenic
962283718 3:134070345-134070367 GAGCCCATGGAGTGGGTGGGAGG + Intronic
962398719 3:135039513-135039535 GAGCCCACGGAGTGGGTGGGAGG + Intronic
964139185 3:153378420-153378442 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
965256809 3:166424209-166424231 GAGGCCATGGAGGGGGTGGGAGG - Intergenic
966221390 3:177555013-177555035 GAGGGCAAGGAGCTGGTGGGTGG + Intergenic
966725039 3:183101173-183101195 GAGCCCATGGAGTGGGTGGGAGG - Intronic
966881937 3:184355429-184355451 CAGGCCTGTGAGGTGCTGGGTGG + Exonic
968446670 4:655603-655625 GAGGCCAGGGCGTGGGTTGGAGG - Intronic
968502421 4:957114-957136 AAGGGCAGGAAGTTGCTGGGAGG - Intronic
968952970 4:3704069-3704091 GAGGCCAGGCAGCAGGTGGGTGG + Intergenic
969213743 4:5707621-5707643 GAAGCCAGGGAGTGGCAGTGGGG + Intronic
969498957 4:7541566-7541588 GTGGCCAGGGCCTTGCTCGGGGG + Intronic
969592543 4:8130229-8130251 GTGGCCAGGGTGGTGCTGGATGG + Intronic
969622813 4:8287149-8287171 GAGGCCAGGGGGCTGCCGTGGGG + Intronic
969654942 4:8491494-8491516 GAGCCCATGGAGTGGGTGGGAGG + Intronic
969660250 4:8523209-8523231 GAGGCCAGGGTGGTGCCGAGGGG + Intergenic
969954774 4:10877632-10877654 AAGACCAGGAAGTTGCTGGGTGG + Intergenic
970391250 4:15615190-15615212 GAGCCCATGGAGTGGGTGGGAGG - Intronic
971553004 4:27978419-27978441 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
971811987 4:31438928-31438950 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
972666166 4:41167210-41167232 GAGCACACGGAGGTGCTGGGAGG - Intronic
972900162 4:43672634-43672656 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
973048608 4:45567329-45567351 GAGCCCAGGGAGTTTGGGGGAGG - Intergenic
973308114 4:48675617-48675639 GAGCCCATGGAGTGGGTGGGAGG - Intronic
974641712 4:64640557-64640579 GAGCCCTTGGAGTTGGTGGGAGG + Intergenic
974804420 4:66860445-66860467 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
976520594 4:86021691-86021713 GAGCCCATGGAGTGGGTGGGAGG + Intronic
976980260 4:91218054-91218076 GAGCCCATGGAGTGGGTGGGAGG + Intronic
977750932 4:100608849-100608871 GAGCCCATGGAGTGGGTGGGAGG + Intronic
978414699 4:108463356-108463378 GGGGACAGGGAAATGCTGGGAGG + Intergenic
979258153 4:118625462-118625484 GGAGCCAGGGAGTTGCTGGGTGG + Intergenic
979258210 4:118625765-118625787 GAGGCCAGGGAGTTGCTGGGTGG + Intergenic
979330139 4:119414803-119414825 GAGGCCAGGGAGTTGCTGGGTGG - Intergenic
979424716 4:120550821-120550843 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
979991498 4:127380211-127380233 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
980043343 4:127964321-127964343 GAGCCCACGGAGTGGGTGGGAGG + Intronic
980628628 4:135406895-135406917 GAGCCCATGGAGTGGATGGGAGG - Intergenic
981129254 4:141140052-141140074 GAGGCCAGGTACTTGCTGTACGG + Intronic
981341344 4:143625379-143625401 GAGGCCAAGGAATTGCATGGGGG - Intronic
982069068 4:151679422-151679444 GAGCCCTGGGACTGGCTGGGAGG + Intronic
982408262 4:155044579-155044601 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
983553020 4:169035919-169035941 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
985195078 4:187420706-187420728 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
985560938 5:585362-585384 TAGGTCAGGGAGTGGGTGGGTGG + Intergenic
985931092 5:3058424-3058446 CAGGCCAGGGAGTTGCACTGGGG - Intergenic
986016395 5:3761319-3761341 AAGGCCAGGGAGATGGAGGGAGG - Intergenic
986016409 5:3761374-3761396 AAGGCCAGGGAGATGGAGGGAGG - Intergenic
986152038 5:5138062-5138084 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
986309935 5:6544329-6544351 GAGGCCAGGAAGGCGCTGGAGGG - Intergenic
986543663 5:8872858-8872880 GGGGCCAGGGAGGAGCTGGAAGG - Intergenic
986698031 5:10375433-10375455 GAGCCCATGGAGTGGGTGGGAGG - Intronic
987079410 5:14412863-14412885 GAGGCCAGAGGTTTGCTGGTGGG - Intronic
987315329 5:16718228-16718250 GAGCCCATGGAGTGGGTGGGAGG - Intronic
987397917 5:17443224-17443246 GGGGGCAGGGAAGTGCTGGGAGG + Intergenic
987455670 5:18142946-18142968 GAGACTAGGGAATTGCTGGGTGG + Intergenic
987876985 5:23691401-23691423 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
988037715 5:25850114-25850136 ATGGACAGGGAGTTCCTGGGTGG - Intergenic
988907904 5:35809012-35809034 AAGGTCAGGGAGTTACTGAGGGG - Intronic
989346830 5:40438936-40438958 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
990461558 5:56035766-56035788 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
991111264 5:62902186-62902208 GGAACCAGGGAATTGCTGGGAGG + Intergenic
991654611 5:68891864-68891886 GGGGCTGGGGAGTTGGTGGGTGG - Intergenic
992701990 5:79350095-79350117 TTGGACAGGCAGTTGCTGGGTGG + Intergenic
993557086 5:89353835-89353857 AAGGTCAGGGAGTTACTGGAGGG - Intergenic
994254760 5:97580078-97580100 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
994605566 5:101962529-101962551 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
994701666 5:103142118-103142140 GAGCCCATGGAGTGGGTGGGAGG + Intronic
994851222 5:105057309-105057331 GAGGCAAGGATGTTCCTGGGTGG + Intergenic
994876597 5:105430963-105430985 GTTGCCAGGGACTTGGTGGGGGG - Intergenic
995596421 5:113753202-113753224 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
995679835 5:114704372-114704394 GAGCCCATGGAGTGGATGGGAGG + Intergenic
995920436 5:117304939-117304961 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
997611903 5:135221259-135221281 CAGGCCTGGGAGGTGGTGGGTGG + Intronic
997760594 5:136444490-136444512 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
999132448 5:149294816-149294838 GAGGCCAGGCTGGGGCTGGGGGG - Intronic
999776874 5:154818960-154818982 AAGGCCAGGGAGATGCTGCCTGG + Exonic
999855249 5:155586836-155586858 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1001517500 5:172366137-172366159 GGGGTCAGGGAGTGGCTGTGAGG + Intronic
1002019918 5:176356935-176356957 GTTGCCAGGGAGTGGGTGGGGGG + Intronic
1002191337 5:177479314-177479336 GAGGCCAGGGTGTGGGTGGCGGG - Intergenic
1002283859 5:178149397-178149419 TGGGCCAGCGAGTTGGTGGGCGG - Exonic
1002471780 5:179439793-179439815 AAGGCCAGGGTGCTGCAGGGAGG + Intergenic
1002708561 5:181180007-181180029 TAGGGCAGGGAGCTGCTGGAAGG - Intergenic
1002774220 6:315018-315040 CTGGTCAGGGAGTGGCTGGGTGG + Intronic
1002792689 6:447420-447442 CAGGCCAGGGAGAGGCTGCGGGG + Intergenic
1002942883 6:1733453-1733475 GAGGCCAGGCAGTGACTGGAGGG + Intronic
1003013848 6:2452045-2452067 GAGGCCAGGGAGGCCCTGTGGGG + Intergenic
1003060760 6:2860417-2860439 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1003170814 6:3720848-3720870 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1003908165 6:10720866-10720888 GAGCCCACGGAGGTGGTGGGAGG - Intergenic
1004906900 6:20244854-20244876 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1005019301 6:21402327-21402349 GTGGCCAGGTGGCTGCTGGGTGG - Intergenic
1005035533 6:21552366-21552388 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1005332843 6:24766019-24766041 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1005738504 6:28770693-28770715 AAAGCCAGGGAGTTGCTAAGGGG - Intergenic
1005759841 6:28958121-28958143 GAGCCCATGGAGTGGATGGGAGG - Intergenic
1006227033 6:32548007-32548029 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1006303653 6:33207058-33207080 GAACCCAGGGAGTTGGGGGGAGG - Intergenic
1006352678 6:33532667-33532689 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1006477867 6:34269303-34269325 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1006511659 6:34524893-34524915 GCTGCCAGGGGGCTGCTGGGGGG - Intronic
1008005556 6:46405850-46405872 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1008087853 6:47263065-47263087 GTGGCCATGGAGGTGATGGGAGG + Intronic
1008263925 6:49400466-49400488 AAGACCCCGGAGTTGCTGGGTGG - Intergenic
1008278280 6:49566040-49566062 GACTCCAGGGAGTGGCTGGAAGG + Intergenic
1008727738 6:54442108-54442130 CAGGGCAGGGAGGTGCTGGGAGG - Intergenic
1009587684 6:65627819-65627841 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1010662036 6:78582816-78582838 AAGGCCAGGCAGTTACTAGGAGG - Intergenic
1011143727 6:84189645-84189667 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1011410177 6:87059630-87059652 GAGGCCAGGGAGGTGGGGGGAGG + Intergenic
1011609901 6:89140703-89140725 GAGGACAGGGAGGTTCTGAGAGG - Intergenic
1011870050 6:91881977-91881999 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1012072359 6:94639557-94639579 CAGGTCAGGGAAGTGCTGGGAGG + Intergenic
1012131221 6:95496804-95496826 GAGGCCGAGGAGGTGCTGAGAGG - Intergenic
1012398578 6:98826084-98826106 GAGACCAGGGAGTTGGTGGGCGG - Intergenic
1012760466 6:103294487-103294509 GAGCCCACGGAGTGGGTGGGAGG + Intergenic
1013081447 6:106816845-106816867 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1013143529 6:107364328-107364350 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1013955308 6:115834683-115834705 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1015729536 6:136334339-136334361 GCGGGCAGGGAGGTGCTGGGAGG + Intergenic
1016067332 6:139697998-139698020 GAGCCCAAGGAGTGGGTGGGAGG + Intergenic
1017299017 6:152834621-152834643 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1017869922 6:158478642-158478664 GAGGCCAGGCAGTTGCAGGGTGG - Intronic
1018215396 6:161521679-161521701 AAGGTCAGGGAGTGGCTGGCTGG + Intronic
1018416020 6:163602884-163602906 GAGGCCCGGGCGCTGCAGGGAGG - Intergenic
1018507907 6:164491237-164491259 GAGGCCAGGCAGCAGCAGGGTGG - Intergenic
1018723027 6:166588337-166588359 GGGGCCAGCGAGTTGCTGCAGGG + Intronic
1019000227 6:168743867-168743889 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1019143260 6:169961575-169961597 CAGGTCTAGGAGTTGCTGGGTGG - Intergenic
1019144065 6:169965659-169965681 CAGGCCAGGGAGTTCATGGATGG + Intergenic
1019281406 7:202262-202284 GAGGACAGGTGGCTGCTGGGTGG + Intronic
1019281473 7:202554-202576 GAGGACGGGTAGCTGCTGGGTGG + Intronic
1019499471 7:1357850-1357872 GAGCCCAGGGAGGGCCTGGGTGG + Intergenic
1019723434 7:2587262-2587284 GGGGCCAGGCAGTGGCTGTGTGG + Intronic
1019729743 7:2623345-2623367 GAGGCCAGGGAGGGGCTGGCAGG + Intergenic
1020241476 7:6398419-6398441 GAGGTCAGGGAGATCCTGAGGGG - Intronic
1020282367 7:6656089-6656111 GAGGCACGGTAGTTGGTGGGTGG + Exonic
1020340030 7:7100173-7100195 GAGGCCAGGGCAGAGCTGGGAGG + Intergenic
1020552245 7:9621565-9621587 GAGCCCACGGAGTTGCGGGGAGG + Intergenic
1020918737 7:14233759-14233781 GAGTCCAGGGAGTGTGTGGGGGG + Intronic
1021009330 7:15442627-15442649 GAGGGCAGGGAAGTGCTGGGAGG + Intronic
1021324161 7:19245761-19245783 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1021450292 7:20778101-20778123 GAGGCCCGGGACTGGCGGGGCGG + Intergenic
1021984774 7:26087822-26087844 GAGGCCAGGGAGTTCCTCAGAGG + Intergenic
1022130496 7:27400564-27400586 GAGCTCAGGGAGATGGTGGGTGG - Intergenic
1022681099 7:32546960-32546982 GAGAGAAGAGAGTTGCTGGGAGG + Intronic
1022923174 7:35036894-35036916 TGAGCCAGGGAGTTGCGGGGAGG + Intronic
1022938376 7:35204433-35204455 AAGGCCATGGAATTGCTGGGAGG - Intronic
1023294913 7:38704512-38704534 GAGTGCAGGGAGTTGCAGAGGGG + Intergenic
1023400138 7:39786755-39786777 GGGGCCAGGGAGTTGCTGGGTGG + Intergenic
1023400195 7:39787059-39787081 GAGGCCAGGGAGTTACTGGGTGG + Intergenic
1024073067 7:45802506-45802528 GGGGCCAGGGAATTGCTGGGTGG + Intergenic
1024073123 7:45802810-45802832 GAGGCCAGGGAGTTACTGGGTGG + Intergenic
1024121473 7:46245614-46245636 GGGGGCAGGGAGATGCTGGTTGG - Intergenic
1024203146 7:47126434-47126456 GACGGCAGGGAAGTGCTGGGAGG - Intergenic
1024340224 7:48250220-48250242 GAGGACATGGAGGTGCTGGGAGG - Intronic
1024650208 7:51397378-51397400 GAGGCCAGGGAGTTACTGGGTGG - Intergenic
1024650266 7:51397682-51397704 GGGGCCAGGGAGTTGCTGGGTGG - Intergenic
1024800184 7:53068163-53068185 GAGGCCAGTATGTGGCTGGGAGG + Intergenic
1024981113 7:55158464-55158486 GAGCCAAGGGAGTTTATGGGAGG - Intronic
1025054355 7:55753027-55753049 GAGGCCAGGGAGTTGCTGGGTGG - Intergenic
1025054410 7:55753332-55753354 GGGGCCAGGGAGTTGCTGGGTGG - Intergenic
1025113322 7:56237370-56237392 GAGGCAGGAGAATTGCTGGGAGG + Intergenic
1025132405 7:56383180-56383202 GAGGCCAGGGAGTTGCTGGGTGG - Intergenic
1025132462 7:56383484-56383506 GGGGCCAGGGAGTTGCTGGGTGG - Intergenic
1025183465 7:56837634-56837656 GAGGCCAGGGAGTTGCTGGGTGG - Intergenic
1025688460 7:63739333-63739355 GAGGCCAGGGAGTTGCTGGGTGG + Intergenic
1025851689 7:65249743-65249765 GAGGCCAGGGAGCTGAGAGGGGG + Intergenic
1025911573 7:65832828-65832850 GAGGCCAGGGAGTCGGTGGGTGG + Intergenic
1025947948 7:66119088-66119110 GAGGCCAGGGAGAATCTGGATGG + Intronic
1025978076 7:66385448-66385470 GAGGCCAGGGAGTTGCTGGGTGG - Intronic
1026044243 7:66894843-66894865 CAGGCCAGGGAGTTGCTAGGCGG + Intergenic
1026187056 7:68090497-68090519 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1026236903 7:68535069-68535091 GAGGCCACGGTGGTGGTGGGTGG + Intergenic
1026512377 7:71037871-71037893 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1027050126 7:75016560-75016582 GAGGCCAGGAAAAGGCTGGGTGG - Intronic
1027203657 7:76080112-76080134 GAGGCCAGGGAGTTGCTGGGTGG - Intergenic
1027214275 7:76173902-76173924 GAGGCCTGGGAGATGCAGGTGGG - Intergenic
1028954166 7:96670513-96670535 GATGCCAGGGAGATGGAGGGTGG + Intronic
1029382909 7:100225108-100225130 GAGGCCAGGAAAAGGCTGGGTGG + Intronic
1029460806 7:100693332-100693354 GTGGCCAGGGAGCTGCTGCACGG + Intergenic
1029567543 7:101348852-101348874 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1030061066 7:105621748-105621770 GAGGCCAGGGAGCTGCTGGGAGG - Intronic
1030733518 7:113017620-113017642 GAGCCCACGGAGTGGGTGGGAGG - Intergenic
1031292226 7:119951594-119951616 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1031907514 7:127476850-127476872 CAGGCCAGGAAGGAGCTGGGAGG - Intergenic
1032050453 7:128646200-128646222 GGGGCCAGGGAGTTGCTGGGTGG + Intergenic
1032050510 7:128646504-128646526 GAGGCCAGGGAGTTGCTGGGTGG + Intergenic
1032240167 7:130153818-130153840 GAGCTCAGGGAGATGCTGTGGGG + Intergenic
1032248106 7:130230299-130230321 GAGACCATGGAGTGGGTGGGAGG - Intergenic
1032539203 7:132689413-132689435 GAGGAAAGGGGGTTGTTGGGGGG - Intronic
1032895839 7:136249987-136250009 GATGACAGGGAGATGCTGGGAGG - Intergenic
1034091082 7:148364085-148364107 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1034155051 7:148949358-148949380 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1034179569 7:149126747-149126769 GAGGCCGGGTAGGTGGTGGGGGG + Intronic
1034217302 7:149418160-149418182 GAGTCCTGGGAGTGGCTGGATGG - Intergenic
1034413283 7:150952364-150952386 GAGGCCAGGAATGTGGTGGGAGG - Intronic
1034426770 7:151018154-151018176 GAGTCTAGGGAGTGACTGGGTGG - Intronic
1034461327 7:151199561-151199583 GAGGTCAGAGACTTGTTGGGGGG - Intronic
1034656005 7:152730359-152730381 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1034927211 7:155131705-155131727 GGGGCCGGGGAGCTGCTAGGAGG - Intergenic
1034972408 7:155427514-155427536 ACGGCCGGGGAGCTGCTGGGGGG - Intergenic
1035129732 7:156640742-156640764 GCGGCCAGGGAGTTGCCTGAGGG + Intronic
1035151151 7:156874089-156874111 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1035375588 7:158404859-158404881 GAGGCCAGGGAGCTGGGGGCTGG - Intronic
1035375658 7:158405048-158405070 GAGGCCAGGGAGCTGGGGGCCGG - Intronic
1035470541 7:159106425-159106447 GAGGCCAGGGAGGGGCAGAGAGG + Intronic
1035470613 7:159106652-159106674 GAGGCCAGGGAGGGGCAGAGAGG + Intronic
1035470620 7:159106671-159106693 GAGGCCAGGGAGGGGCAGAGAGG + Intronic
1035470627 7:159106690-159106712 GAGGCCAGGGAGGGGCAGAGAGG + Intronic
1035764717 8:2096876-2096898 GAGGCAAGGGACTCTCTGGGAGG - Intronic
1035999274 8:4583104-4583126 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1036222144 8:6929807-6929829 CAGGCCCGGGAGTTGCTGTGTGG - Intergenic
1037241586 8:16784183-16784205 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1037263810 8:17036901-17036923 GAGCCCACGGAGTGGGTGGGAGG + Intronic
1037635773 8:20700190-20700212 GAGGGGAGGGAGTTTCCGGGAGG + Intergenic
1037906731 8:22719786-22719808 AAGGCCAGGGAGGGGCAGGGTGG + Intronic
1037983559 8:23272393-23272415 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1038174102 8:25164773-25164795 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1038726498 8:30086837-30086859 GAATACAGGGAGGTGCTGGGAGG - Intergenic
1039061340 8:33574180-33574202 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1039284895 8:36029103-36029125 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1039415293 8:37388524-37388546 GTGGAGAGGGAGTTCCTGGGTGG + Intergenic
1039749709 8:40466149-40466171 GAGGCCTGGGAGTATCTGGGAGG - Intergenic
1039841689 8:41297975-41297997 GATGCCAGGGAAGTGCTGGTGGG + Intronic
1039903410 8:41768531-41768553 GAGCCCAGGGAGGTAATGGGTGG + Intronic
1040108692 8:43555792-43555814 AAAGCCAGGGAGTTGCTAAGGGG - Intergenic
1041918961 8:63162266-63162288 GAGTCCATGGAGTGGGTGGGAGG - Intergenic
1042461910 8:69079760-69079782 GAGGCCTGGGAATTGCTGAATGG + Intergenic
1042512536 8:69626568-69626590 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1042931000 8:74014049-74014071 GCGGCCAGGGAGTAGCAGGGAGG + Intronic
1043709919 8:83403223-83403245 GAGCCCATGGAGTGGGTGGGTGG - Intergenic
1043889641 8:85642365-85642387 GAGGCCAGGGAAGTGCAGGTGGG + Intergenic
1045131910 8:99163483-99163505 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1045717656 8:105067260-105067282 GGGGGCAGGGAAGTGCTGGGAGG - Intronic
1046260821 8:111765653-111765675 GGGGTCAGGGAAGTGCTGGGAGG + Intergenic
1046265359 8:111823375-111823397 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1046439130 8:114236186-114236208 GAGGGCAGGGAAGTGCTAGGAGG + Intergenic
1046445372 8:114311627-114311649 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1048261191 8:132946615-132946637 GAGGCTAGAGACTTGTTGGGAGG - Intronic
1048309337 8:133306569-133306591 CTGGGCAGGGACTTGCTGGGAGG - Intergenic
1048671787 8:136730651-136730673 AAGGGCAGGGAAGTGCTGGGAGG - Intergenic
1048973263 8:139656959-139656981 GAGGCCAAGGGGCTGCAGGGGGG - Intronic
1049095463 8:140545721-140545743 GAGCCCTGGGACTTGCTGGCAGG - Intronic
1049182124 8:141228301-141228323 GCCCCCTGGGAGTTGCTGGGAGG - Exonic
1049355989 8:142188315-142188337 CAGGACAGGGCCTTGCTGGGTGG + Intergenic
1049427441 8:142543714-142543736 GAGGGCAGGGAGGGGCGGGGTGG + Intronic
1049728567 8:144163532-144163554 CAGGCCAGTGAGGTGCTGGTAGG + Intronic
1049738680 8:144223569-144223591 GAGTCCTGGGAGCTGCTGAGAGG - Intronic
1050920646 9:11197142-11197164 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1051463831 9:17354211-17354233 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1051892729 9:21959527-21959549 GAGCCCATGGAGTGGGTGGGAGG - Intronic
1051965002 9:22816815-22816837 AAGGCCATGGGGTTGTTGGGGGG - Intergenic
1052985314 9:34482848-34482870 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1053027252 9:34740320-34740342 GAGCCCACGGAGTGGGTGGGAGG + Intergenic
1053069847 9:35094848-35094870 GAGGCCAGGGCCCTGCTGGTAGG - Intronic
1053069861 9:35094902-35094924 GAGGCCAGGGCCCTGCTGGTAGG - Intronic
1053255399 9:36613048-36613070 GAGGGCAGTGAGGTGATGGGAGG - Intronic
1053291002 9:36879629-36879651 GAAGCCAGGGAATTTCCGGGGGG - Intronic
1053344050 9:37364961-37364983 GAGGCTGGGGACTTGCTGTGTGG - Intergenic
1053354944 9:37437657-37437679 GGGGGCAGGGAGGGGCTGGGGGG - Intergenic
1053471864 9:38352362-38352384 GAGGACAGGGAGTGGCAGTGAGG - Intergenic
1053547880 9:39042441-39042463 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1053812003 9:41862482-41862504 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1054452337 9:65409881-65409903 GAGGCCAGGGTGGTTCCGGGAGG + Intergenic
1054618592 9:67324957-67324979 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1054902746 9:70387429-70387451 GAGGGTAGGGAGTGGGTGGGGGG - Exonic
1055054450 9:72010913-72010935 GGGGGCAGGGAAGTGCTGGGAGG - Intergenic
1056502638 9:87224745-87224767 AAGGCCAAGGAGGTGGTGGGTGG + Intergenic
1056573326 9:87834942-87834964 GGGGGCAGGGAAATGCTGGGAGG - Intergenic
1056771361 9:89480502-89480524 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1056789153 9:89614620-89614642 AAGTCCAGGGAGTTGGTAGGTGG + Intergenic
1057053243 9:91941754-91941776 GAGGGCAGGGCGGGGCTGGGCGG - Intronic
1057177240 9:93009446-93009468 GAGGCCCTTGAGTTGCTGGCAGG + Intronic
1057383888 9:94591228-94591250 GAGCCCATGGAGTGGATGGGAGG + Intronic
1057543828 9:96001803-96001825 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1057628599 9:96700972-96700994 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1057997794 9:99835485-99835507 GAGGCCAGGGTGCTTCTGGGAGG - Intronic
1058432818 9:104933800-104933822 GAGGCCAGGGACGGGTTGGGGGG + Intergenic
1058786530 9:108393790-108393812 GAGCCCACGGAGTGGGTGGGAGG - Intergenic
1058902494 9:109454211-109454233 GAGGCCAGGGAGGTGGAAGGAGG + Intronic
1059407133 9:114108318-114108340 GGGGGCAGGGGGTTGGTGGGAGG - Intergenic
1059428932 9:114238454-114238476 GAGGCTAGGGAGTTGTGGGTGGG - Intronic
1059440874 9:114306160-114306182 GAGGAAGGGGAGGTGCTGGGGGG - Intronic
1059991531 9:119870366-119870388 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1060266370 9:122113826-122113848 GAGGCCAGGGGATTGCAGGGAGG + Intergenic
1060496979 9:124126121-124126143 GAGGCAAGTGACTTGCTTGGAGG + Intergenic
1060518349 9:124279759-124279781 GCAGCCAGGGAGTGACTGGGTGG - Intronic
1061155555 9:128858909-128858931 GAGGCAAGGGAATTGCTTGGAGG + Intronic
1061389514 9:130309786-130309808 GGGGCCTGGGAGATGGTGGGTGG - Intronic
1061412160 9:130427617-130427639 GAGGTGAGGGAGCTGCCGGGAGG + Exonic
1061761492 9:132854999-132855021 GAGGCCAGGGCGTTGGTGAAGGG - Intronic
1061864650 9:133485977-133485999 CAGCCCAGGGTGTCGCTGGGAGG - Intergenic
1061888717 9:133606445-133606467 GAGGCCAGGGTGGGGCTGGGGGG - Intergenic
1062062011 9:134501901-134501923 GAGGCGAGGGGGCTGCTGGGAGG + Intergenic
1062194186 9:135264008-135264030 GAGGGCAGGGAGTGGGGGGGAGG - Intergenic
1062345030 9:136110624-136110646 GAGGGCAGGCAGTGGCTGGAAGG - Intergenic
1062386927 9:136316197-136316219 GAGGTCGGGGAGTTGCTCAGTGG + Intergenic
1062394314 9:136346629-136346651 CAGGCCTGGGTCTTGCTGGGGGG - Intronic
1062398637 9:136362933-136362955 GAGGCCAGGGTACTTCTGGGTGG + Intronic
1062413096 9:136434532-136434554 GTGGCCAGGGAGGTGCAGGTGGG + Intronic
1062569848 9:137179980-137180002 GGGGACACGGGGTTGCTGGGAGG + Intronic
1062699560 9:137891868-137891890 GAGGGCAGGGACTGGGTGGGGGG - Intronic
1185647254 X:1624501-1624523 GACCCCAGGCAGATGCTGGGAGG + Intronic
1185647265 X:1624532-1624554 GACCCCAGGCAGATGCTGGGAGG + Intronic
1185647325 X:1624718-1624740 GACCCCAGGCAGATGCTGGGAGG + Intronic
1185647343 X:1624780-1624802 GACCCCAGGCAGATGCTGGGAGG + Intronic
1185647384 X:1624904-1624926 GACCCCAGGCAGATGCTGGGAGG + Intronic
1185647403 X:1624966-1624988 GACCCCAGGCAGATGCTGGGAGG + Intronic
1185666044 X:1766449-1766471 GAGGCAAGGTGGTTGGTGGGAGG - Intergenic
1185959951 X:4538562-4538584 GAGGCCAGGGGGCTGCGGGGAGG + Intergenic
1186192014 X:7075689-7075711 GAGCACATGGAGGTGCTGGGAGG + Intronic
1186323222 X:8452575-8452597 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1187005812 X:15231815-15231837 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1187138445 X:16570757-16570779 GAGGACAGGGAAGTGCTGGGAGG + Intergenic
1187904044 X:24049968-24049990 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1188980245 X:36720820-36720842 GAGGCCAGGGAGTTGGCTGGGGG + Intergenic
1189082702 X:37991557-37991579 GAGGCCAGGGAGTTGGCTGGGGG + Intronic
1189309714 X:40010700-40010722 GAGGCGAGGGAGCTTCTGTGCGG - Intergenic
1189600772 X:42622621-42622643 GAGGACAGGGAAGTGGTGGGTGG + Intergenic
1189642356 X:43086303-43086325 CAGGGCAGGGACGTGCTGGGAGG - Intergenic
1189992257 X:46606614-46606636 AAGGCGAGGCAGGTGCTGGGTGG - Exonic
1190708215 X:53048336-53048358 GAGGCCAGGGAGCAGCCGGCTGG - Intergenic
1191256384 X:58281384-58281406 GAGGTCAGGGACTTCCTGGCAGG - Intergenic
1192235676 X:69294106-69294128 TGGGCTAGGGAGTGGCTGGGAGG + Intergenic
1192869631 X:75173682-75173704 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1192870539 X:75179602-75179624 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1193423171 X:81308606-81308628 GAGCCCAGGGAGTTGCCATGGGG - Intergenic
1193538127 X:82738288-82738310 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1194071569 X:89331114-89331136 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1194166377 X:90521611-90521633 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1194650792 X:96512336-96512358 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1195744412 X:108101743-108101765 GTTGCCAGGGGGTTGGTGGGGGG - Intronic
1196662500 X:118282826-118282848 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1196706430 X:118721325-118721347 GAGGCCAGGGAGCTTCTGAAAGG + Intergenic
1196714645 X:118799232-118799254 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1196728900 X:118922068-118922090 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1196762317 X:119210964-119210986 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1196771529 X:119299957-119299979 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1196781436 X:119387669-119387691 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1196793953 X:119487948-119487970 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1196827240 X:119750906-119750928 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1197079033 X:122389359-122389381 GAGGCCAAGGAGGTGCTGAGAGG + Intergenic
1197340083 X:125255923-125255945 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1197892237 X:131279048-131279070 TTGGCCAGGGAGTGGCTGGTTGG - Intronic
1199009910 X:142745808-142745830 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1199028770 X:142972221-142972243 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1199724731 X:150568845-150568867 GAGGCCAGGGAGCAGCAGGCAGG + Intronic
1200100584 X:153687772-153687794 GAGGGCAGGGAGGAGGTGGGCGG + Intronic
1200725807 Y:6666843-6666865 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1200733445 Y:6768214-6768236 GATGCCAGGGATTTGTTGGAAGG + Intergenic
1200824264 Y:7622301-7622323 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1200888703 Y:8298893-8298915 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1201282873 Y:12356461-12356483 AAAGCCAGGGAGTTGCTAAGGGG - Intergenic
1201495665 Y:14589868-14589890 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1201496905 Y:14598281-14598303 GAGCCCATGGAGTGGGTGGGAGG + Intronic
1201563953 Y:15346832-15346854 GAGCACACGGAGGTGCTGGGAGG + Intergenic
1201982593 Y:19923801-19923823 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1202235790 Y:22708786-22708808 GAGCCCATGGAGTGGGTGGGAGG - Intergenic
1202307373 Y:23487382-23487404 GAGCCCATGGAGTGGGTGGGAGG + Intergenic
1202563432 Y:26183204-26183226 GAGCCCATGGAGTGGGTGGGAGG - Intergenic